Visitors Counter

685953

Department of Biotechnology and Biochemistry

Department of Biotechnology published whole genome sequence of sclerotium rolfssi (Groundnut stem rot) First time in the world
Professor & Head  : Dr. H. P. Gajera,  Ph.D.
Contacts                 : 0091-285-2672080-90-379 (Office)
                               : E-mail: This email address is being protected from spambots. You need JavaScript enabled to view it.
Faculty Strength (Current Position)
Sr. No.
Name
Designation
Higher Qualification
Experience (Years)
1.
Dr. H. P. Gajera
Professor and Head
Ph. D.
31
2.
Dr. U. K. Kandoliya
Professor
Ph. D.
31
3.
Dr. M. V. Parakhia
Associate Professor 
Ph.D.
16
4. Dr. Y. V. Naghera Associate Professor Ph. D.  14
5.
Dr. A. G. Vala
Assistant Professor
Ph. D.
10
6.
Dr. S. B. Bhatt
Assistant Professor
Ph. D.
10
7. Dr. D. G. Hirpara Assistant Professor Ph. D.  -
8. Dr. Jay M. Khaniya Assistant Professor  Ph. D.  2
9. Dr. H. R. Sodhaparmar Assistant Professor Ph. D.  -
10. Dr. Shraddha. R. Parmar Assistant Professor  Ph. D.  -
Technical Staff (Current Position)
Sr. No.
Name
Designation
Qualification
Experience
(Years)
1.
Mr. N. A. Patel
Agril. Officer
M.Sc. (Agri.)
13
2.
Mr. A. R. Japda
Agril. Officer
M.Sc. (Agri.)
10
3.
Miss. J. K. Manavar
Lab.Technician
M.Sc. (Home science)
16
4.
Miss. N. S. Vaghani
Lab.Technician
M.Sc. (Chemistry)
16
5.
Mr. H. Z. Hirpara
Lab.Technician
M.Sc. (Chemistry)
16
6.
Mr. V. G. Vyas
Lab.Technician
M. Sc. (Chemistry)
16
7.
Mr. V. K. Bajaniya
Lab.Technician
M.Sc. (Chemistry)
16
8.
Mr. R. L. Bhalara
Lab.Technician
M. Sc. (Micro.) & DMLT
16
9.
Miss. S. V. Bharadava
Agril. Assistant
Polytech. in Agri.
07
10. Mr. G. N. Bandhiya Agril. Assistant B.Sc. (Hons.) Agri. 07

Supporting Staff (Current Position)

Sr. No.
Name
Designation
Qualification
Experience
1.
Mr. A. N. Dabhi
Computer Programmer
M.C.A. & PGDCA
16
2.
Mr. D. M. Parmar
Sr. Clerk
B.Com.
16
3. Mr. B. B. Patel Store keeper 12th pass  27
Courses Offered at UG /PG and Others(Current Year Odd & Even Sem.)

(A)  Post Graduate Courses

Teacher
Odd / Even
Course No.
Title of the course
Credit
PLANT MOLECULAR BIOLOGY AND BIOTECHNOLOGY
Dr. H. P. Gajera
Even
MBB-501
Principles of Biotechnology
3+0
Dr. A. G. Vala
Odd
MBB 502
Fundamentals of Molecular Biology
3+0
Dr. S. B. Bhatt
Odd
MBB 503
Molecular Cell Biology
3+0
Dr. M. V. Parakhia
Even
MBB 504
Techniques in Molecular Biology-I
0+3
Dr. M. V. Parakhia
Odd
MBB 505
Omics and Systems Biology
2+1
Dr. M. V. Parakhia
Odd
MBB-508
Introduction to Bioinformatics
2+1
Dr. M. V. Parakhia
Odd
MBB-509
Techniques in Molecular Biology-II
0+3
Dr. A. G. Vala
Odd
MBB 511
Molecular Plant Breeding
2+1
Dr. U. K. Kandoliya
Even
MBB-512
Immunology and Molecular diagnosis
2+1
Dr. H. P. Gajera
Dr. D. G. Hirpara
Even
MBB-514
Nano Biotechnology
2+1
Dr. H. P. Gajera
Odd
MBB-601
Plant Molecular Biology
3+0
Dr. A. G. Vala
Odd
MBB-602
Plant Genome Enginerring
3+0
Dr. M. V. Parakhia
Even
MBB-603
Advances in Microbial Biotechnology
3+0
Dr. S. B. Bhatt
Even
MBB-605
Plant Microbe Interaction
2+0
Dr. M. V. Parakhia
Even
MBB-606
RNA biology
1+0
Biochemistry
Dr. H. P. Gajera
Odd
Biochem.-501
Basic Biochemistry
3+1
Dr. U. K. Kandoliya
Odd
Biochem.-506
Techniques in Biochemistry
2+2
Dr. S. B. Bhatt
Odd
Biochem.-506
Immunochemistry
2+1
Dr. H. P. Gajera
Odd
Biochem.-602
Advanced Molecular Biology
3+0
Dr. U. K. Kandoliya
Odd
BIOCHEM 603
Biochemistry of Biotic and Abiotic Stresses
3+0
Dr. U. K. Kandoliya
Odd
BIOCHEM 505
Techniques in Biochemistry
2+2
Dr. S. B. Bhatt
Even
Biochem.-503
Enzymology
2+1
Dr. U. K. Kandoliya
Dr. H. R. Sodhaparmar
Even
BIOCHEM 607
Advanced Techniques in Biochemistry
1+2
Dr. U. K. Kandoliya
Even
BIOCHEM 605
Genomics, Proteomics and Metabolomics
3+0

(B)  Under Graduate Programme,B.Sc. (Hons.) Agri.

Teacher
Odd / Even
Course No.
Title of the course
Credit
Dr. U. K. Kandoliya
Even
BIOCHEM 2.1
Fundamentals of Plant Biochemistry
3 (2+1)
Dr. M. V. Parakhia
Even
(Khapat)
Ag. Micro. 6.2
Biopesticides and Biofetilizers
3(2+1)
Dr. S. B. Bhatt
Even
Ag. Micro 6.2
Biopesticides and Biofetilizers
3(2+1)
Dr. A. G. Vala
Odd
Biotech. 5.1
Introductory Biotechnology
3 (2+1)
Dr. M. V. Parakhia
Odd
(Khapat)
Ag. Micro 1.1
Agricultural Microbiology
2 (1+1)
Dr. S. B. Bhatt
Odd
Ag. Micro 1.1
Agricultural Microbiology
2 (1+1)

(C)  Under GraduateProgramme, B.Sc. (Hons.) Horti.

Teacher
Odd / Even
Course No.
Title of the course
Credit
Dr. U. K. Kandoliya
Odd
BSC 1.1
Elementary Plant Biochemistry
2 (1+1)
Dr. A. G. Vala
Odd
BSC 3.7
Elementary Plant Biotechnology
2 (1+1)

(D)  Polytechnic / Agro Based ITI

Teacher
Odd / Even
Course No.
Title of the course
Credit
Dr. M. V. Parakhiya
Odd
Ag. Micro. 5.1
Agril. Microbiology
2(1+1)
Mr. A. R. Japda
Odd
BSC 5.7
Elementary Plant Biochemistry
2(1+1)
Laboratory Facility
Sr. No.
Name of Lab.
Seating Capacity
Purpose
UG or PG
1.
PG Laboratory
35
PG Practical and Research
PG
2.
UG Laboratory
40
UG Practical
UG
3.
Food Testing Laboratory
 
PG Research, Departmental Research and
Commercial Sample Analysis
PG Research and Samples
 
A.  Biotech Cell
10
 
B.  Genomic Cell
5
 
C.  Bioinformatics Cell
5
 
D.  Proteomic Cell
10
 
E.  Microbial Cell
10
 
F.  MS/MS Cell
5
 
G.  GFQA Cell
10
 
H.  Separation Cell
10
 
I.  Elemental Cell
10
Click here to see the List of Major Equipment / Instruments
Click here to see the Images of Lab activities
M.Sc/Ph.D. Students Guided
Name of Guide
No. of students being supervised (guided) by faculty
M.Sc. (Agri.)
Ph.D.
PLANT MOLECULAR BIOLOGY & BIOTECHNOLOGY
Dr. B. A. Golakiya
-
08
Dr. K. H. Dabhi
04
-
Dr. D. N. Vakhariya
-
02
Dr. T. Radhakrishnan
-
02
Dr. S. V. Patel
04
-
Dr. M. K. Mandavia
04
03
Dr. H. P. Gajera
08
11
Dr. R. S. Tomar
10
04
Dr. D. R. Mehta
04
03
Dr. R. B. Madariya
02
-
Dr. U. K. Kandoliya
11
02
Dr. G. V. Maraviya
06
-
Dr. M. K. Mahatma
02
-
Dr. Ashishkumar Vala
06
01
Dr Shraddha Bhatt
03
-
Dr. M. V. Parakhia 02 -
Biochemistry
Dr. D. N. Vakhariya
-
01
Dr. S. V. Patel
04
-
Dr. M. K. Mandavia
02
05
Dr. H. P. Gajera
08
04
Dr. U. K. Kandoliya
07
01
Dr. G. V. Maraviya
03
-
Dr. P. J. Rathod
05
-
Dr. M. K. Mahatma
-
-
Dr. Sarang S. Sapre
01
-
M.Sc. Theses Submitted
Sr. No.
Title of the thesis
Name of the student
Name of guide
Plant Molecular Biology and Biotechnology
Year 2015-16
1.
Molecular perspectives of Trichoderma strains and their antifungal activities during in vitro antagonism with Sclerotium rolfsii (Groundnut)
Hirpara Darshna G. (J4-01039-2012)
Dr. H. P. Gajera
2.
Molecular characterization of ridge gourd (Luffa acutangula L.) and sponge gourd (Luffa cylindrica L.)genotypes through PCR based molecular markers
Rathod Ravikumar R. (J4-01073-2012)
Dr. D. R. Mehta
3.
Molecular and Biochemical evaluation for drought tolerance in bread wheat (Triticum aestivum L.)
Gajera Hitesh P.  (J4-01036-2012)
Dr. S. V.Patel
4.
Characterization of pyriculariya leaf spot resistant and susceptible pearl millet genotypes using biochemical and molecular markers
Vaja Vidushibahen N. (J4-01088-2012)
Dr. H. P. Gajera
5.
Molecular and biochemical characterization of leaf rust resistant and susceptible wheat (Triticum aestivum L.) genotypes
Bhimani Rahul D.  (J4-01023-2012)
Dr. K. H. Dabhi
6.
Characterization of phytophthora blight resistant and susceptible sesame (Sesamum indicum  L.) genotypes using molecular markers
Karad Kirtikumar D. (J4-01048-2012)
Dr. S. V. Patel
7.
Characterization of drought resistance and susceptible pearl millet (Pennisetumglaucum (L.) genotypes using biochemical and molecular markers.
Parmar Suhani B. (J4-01063-2012)
Dr. M. K. Mandavia
Year 2016-17
8.
Genetic diversity analysis of Ber (Ziziphus mauritiana l.) varieties through PCR based molecular markers
Dobariya Ashok B.  (J4-01140-2013)
Dr. G. V. Marviya
9.
Diversity analysis of fenugreek (Trigonella foenum graceum L.) through molecular and biochemical markers
Korat Avni  N. (J4-01162-2013)                                                      
Dr. U. K. Kandoliya
10.
Genetic diversity analysis among coconut (Cocos nucifera L.) Genotypes and hybrids by biochemical and molecular marker
Joshi Ankitaben K. (J4-01153-2013)                                                      
Dr. U. K. Kandoliya
11.
Molecular and biochemical  characterization of chrysanthemum (Dendranthema grandiflora Tzevlev)
Awinash Gowda H. (J4-01335-2014)                                                       
Dr. K. H. Dabhi
Year 2017-18
12.
Molecular and phytochemical characterization of algal species from coastal belt of Okha region
Chudasama Amar A. (J4-01355-2014)                                                       
Dr. U. K. Kandoliya
13.
Molecular characterization for drought tolerance in cotton
Bhadani Rushitaben V. (J4-01342-2014)                                                      
Dr. S. V. Patel
14.
Molecular characterization of tomato (Solanum esculentum) genotypes for leaf curl viruses (ToLev)
Jayashree M. J. (2010115037)                                                      
Dr. U. K. Kandoliya
15.
Expression analysis of polyamines and ethylene biosynthesis genes in groundnut (Arachis hypogaea L.) during stem rot disease
Rakesh Nogiya (J4-01404-2014)                                                      
Dr. M. K. Mahatma
16.
Genome sequencing of Dill (Anethum graveolens L.) for development and validation of simple sequence repeat markers
Shiwani (2010115084)                                                     
Dr. M. K. Mandavia
17.
Molecular characterization of groundnut varieties differing in tolerance to aflatoxin production
Rahul Rammani Tripathi (J4-01400-2014)                                                       
Dr. H. P. Gajera
18.
Molecular screening and characterization of castor genotypes for root rot disease
Kachhadiya Harshita J. (J4-01371-2014)                                                      
Dr. R. B. Madariya
19.
Identification and validation of microsatellite markers through assembly of a partial genome for fennel (Foeniculum vulgare M.)
Pala Abhay B. (J4-01390-2014)                                                      
Dr. R. S. Tomar
20.
Molecular characterization of pearl millet (Pennisetum glaucum (L.) R. Br.) genotypes for salinity tolerance
Ravindrakumar Vijaykumar Baria 
(J4-01410- 2014)                                              
Dr. G. V. Maraviya
 
21.
Evaluation of biochemical and molecular markers associated with salt tolerance in wheat genotypes
Pansuria Kruti C. (J4-01392-2014)
Dr. S. V. Patel
 
22.
De nova sequencing of ancient seed spice celery (Apium graveolens L.) and development of microsatellites
Shefalee Kishorbhai Parmar
(J4-01416-2014)
Dr. M. K. Mandavia
 
23.
Molecular screening and characterization of castor genotypes for fusarium wilt resistance
Makwana Monika S. (2010115049)
Dr. R. B. Madariya
 
24.
Morphological, biochemical and moleculer characterization of brinjal (Solanum melongena L.)genotypes through PCR based molecular markers
Rucha Rajendrakumar Patel
(J4-001184-2013)
Dr. D. R. Mehta
25.
Diversity analysis and sex determination in spine gourd (Momordica dioica Roxb.) using biochemical and molecular markers
Hirani Nimishaben V. (2010115028)
Dr. D. R. Mehta
26.
Development of genome wide simple sequence repeat markers using genome sequence of ajwain (Trachyspermum ammi L.)
Jogarana Mayur R. (J4-01370-2014)
Dr. R. S. Tomar
Year 2018-19
27.
Differential gene expression of GNAC TFs for drought stress in groundnut
Thoppurathu Feba Jacob (2010116121)
Dr. A. G. Vala
28.
Transcriptome profiling associated temperature and their gene expression in chickpea 
Pandya Pryankaben M. (2010116085)
Dr. M. K. Mahatma
29.
Molecular characterization of garlic (Allium sativum L.) genotypes differ in total soluble content 
Umaretiya Vidishaben R. (2010115088)
Dr. G. V. Maraviya
30.
Efficacy of thiourea application on biochemical changes in chickpea (Cicer arientium L.) under water deficit stress 
Makadiya Mahek B. (2010115048)
Dr. M. K. Mandavia
31.
Molecular characterization of blackgram(Vigna mungo (L.) Hepper) genotypes for saline water tolerance. 
Mukul Kumar Gandhi (2010116080)
Dr. G. V. Maraviya
32.
Molecular and biochemical characterization of wheat genotypes under heat stress condition
Kapadiya Kishan B. (2010116064)
Dr. K. H. Dabhi
33.
Differential gene expression of aquaporin for salinity stress in groundnut
Joshi Meeraben K. (2010116055)
Dr. G. V. Maraviya
34.
Molecular and isoenzymic characterization of indian bean (Lablab purpureus L.) genotypes
Dholakia Hemang P. (2010116034)
Dr. D. R. Mehta
35.
Phylogenetic relationship and molecular diversity analysis of promising genotypes and cultivers of mustard (Brassica juncea L.)
Moghariya Nikulkumar K. (2010115052)
Dr. H. P. Gajera
Year 2019-20
36.
Isolation and characterization of entomopathogenic microbes from the soils
Hirapara Kinjalkumari M.  (2010117047)
Dr. S.B. Bhatt
37.
"Genome and transcriptome sequencing of barnyard millet (Echinochloa esculenta L.) for the development of geneic SSR marker and diversity analysis" 
Meniya Vipul H. (2010117076)
Dr. R. S. Tomar
38.
"Genome and transcriptome sequencing of kodomillet (Paspalum scrobiculatum L.) for the development of geneic  marker and diversity analysis" 
Humble Nehali B. (2010117050)
Dr. R. S. Tomar
39.
Isolation, characterization and identification of halophilic bacteria from the soils of coastal regions of  saurashtra
Likhindra Reang (2010117069)
Dr. S.B. Bhatt
40.
Genome and transcriptome sequencing of little millet (Panicum sumatense Roth.) for the development of genic SSR markers and its validation
Bhut Nishant H. (2010117019)
Dr. K.H.Dabhi
41.
Biochemical and molecular characterization for aroma in rice (Oryza sativa L.) genotypes of Gujarat region
Patil Rahul Ishwar. (2010117102)
Dr. A.G.Vala
Year 2020-21
42.
Molecular characterization and proximate composition of Maize (Zea mays L.)
Savaliya Nidhiben V. (2010118088)
Dr. G.V. Marviya
43. Genetic characterization and diversity of nitrogen fixing Rhizobium Spp. isolated from root nodules of legumes  Muchhadiya Pooja M. (2010118065)

Dr. S. B. Bhatt

44. Molecular diversity in onion(Allium cepa L.) genotypes

Sojitra Nidhee P. (2010118093)

Dr. R. B. Madariya
45. Transcriptome profiling of in vitro regenerated Stevia rebaudiana genotypes and identification of candidate genes encoding steviol glycosides Gadhiya Jaykumar A.(2010118026)

Dr. A. G. Vala

46. Identification and characterization of candidate genes for drought and salinity tolerance in pearl millet  [pennisetum glaucum l.]

Supreeth H.P.  (2010118097)

Dr. R. S.Tomar

Year 2021-22
47. Assessing genetic diversity of kodo millet (Paspalum scrobiculatum L.)genotypes using molecular markers 

Thakkar Tirth K. (2010119102)

Dr. S. B. Bhatt

48. Molecular marker based genetic diversity analysis in barnyard millet (Echinochloa frumentacea L.)

Jethava Kinjal M. (2010119044)

Dr. S. B. Bhatt

49. Molecular diversity in Mustard (Brassica juncea L.)genotypes Thummar Shweta D. (2010119104)

Dr. R. B. Madariya

50. Development and utilization of molecular markers to study genetic diversity in sugarcane(Saccharum officinarum L.)

Jayasuriya U.S. (2010119042)

Dr. R. S. Tomar

51. Development and validation of molecular marker for fresh seed dormancy in groundnut (arachis hypogaea l.) Rathava Rajeshvari I. (2010119087)

Dr. S. Chandramohan

52.

Molecular and biochemical variability in promising genotypes of black sesame (Sesamum indicum l.)

Moliya Romik M. (2010119070)

Dr. U.K.Kandoliya

53.

Nutritional, anti-nutritional and molecular characterization of selected genotype of kabuli chickpea (Cicer arietinum L.)

Tajender kumar (2010119099)

Dr. U.K.Kandoliya

Dr. H.P.Gajera
Year 2022-23
54. Metagenomic profiling of soil microbial communities associated with halophytes

Kratika Nigam (2010120049)

Dr. R. S.Tomar

55. Development and validation of SSR markers linked to stemrot disease resistance in groundnut

Gadge Vaishnavi Rajendra (2010120025)

Dr. Sangh Chandramohan
56. Molecular characterization, nutritional and antinutritional parameters of promising genotypes of black gram [vigna mungo (l.) hepper]

Patel Kalpanabahen K. (2010120068)

Dr. U.K.Kandoliya

57. Molecular characterization , nutritional and antinutritional parameters of promising mung bean(Vigna radiata (L.) Wilczek) genotypes

Taviyad Krishnaben L. (2010120085)

Dr. U.K.Kandoliya

58. RNA- SEQ for differentially expressed gene(s) regulating drought and salt stress response in barnyard millet(Echinochola frumentaces L.)

Vaghela Tejasvini Indrajit  (2010120089)

Dr. A.G.Vala

59. Genetic diversity analysis in groundnut (Arachis hypogaea l.) Based on molecular markers and biochemical parameters

Jivani Jankiben M. (2010120038)

Dr. G.V.Maravia

Year 2023-24
60.
Molecular markers based genetic diversity analysis in finger millet [Eleusine coracana (L.) gaertn.]
Dudhatra Rutu Jayesh bhai (2010121018)
Dr. S. B. Bhatt
61.
Assessment of molecular diversity and proximate composition in millets
Chovatiya Neha Dineshbhai (2010121013)
Dr. M. V. Parakhia
62.
Molecular and biochemical characterization of promising okra (Abelmoschus esculentus) genotypes
Aashima Khajuria (2010121070)
Dr. U. K. Kandoliya
Year 2024-25
63.
Molecular and metabolomic characterization of coconut (Cocos nucifera L.) genotypes
Patel Jahanvi Nandlalbhai (2010122049)
Dr. U. K. Kandoliya
64.
Molecular characterization and biochemical analysis of promising indian bean [Lablab purpureus (L.) Sweet] genotypes
Gorfad Twinkal Dilipbhai (2010122029)
Dr. U. K. Kandoliya
65.
Isolation and molecular characterization of endophytic microorganisms from parthenium hysterophorus L. and portulaca oleracea L. for promoting plant growth
Bhuva Krishna Pravinbhai (2010122010)
Dr. M.V.Parakhia
66.
Physio-biochemical and molecular characterization of Indian mustard (Brassica juncea (L.) Czern.) under heat stress condition”
Savaliya Foram Arvindbhai (2010122063)
Dr. A. G. Vala
67.
Identification and characterization of diatoms response to sea water
Gowruneni Mounika (2010122082)
Dr. A. G. Vala
68.
Evaluation of molecular diversity and antimicrobial potential of endophytic bacteria from leaves of medicinal plants 
Chavda Vaishali Ravjibhai (2010122014) 
Dr. S. B. Bhatt
Biochemistry
Year 2015-16
1.
Biochemical changes in pearl millet (Pennisetum glaucum L.) seedling in response to chloride based salinity
Pansuriya Kalpesh R. (J4-01173-2013)
Dr. S. V. Patel
2.
Biochemical changes in pearl millet (Pennisetum glaucum L.) seedling in response to sulphate based salinity
Ukani Piyush K. (J4-01198-2013)
Dr. H. P. Gajera
3.
Evaluation of phenolics and antioxidant enzyme systems for fusarium wilt resistance in chickpea (Cicer arietinum L.) and their relationship with STMS markers
Chirag Vallabhbhai Patel (J4-01025-2012)
Dr. H. P. Gajera
4.
Evaluation of phenolics and antioxidant enzyme systems for phytophthora blight resistance in sesamum (Sesamum indicum L.)
Mori Disha S. (J4-01057-2012)
Dr. S. V. Patel
5.
Antioxidant and phytochemical characterization of custard apple (Annona squamosa L.)
Yashwant Kumar (J4-01093-2012)
Dr. H. P. Gajera
Year 2016-17
6.
Effect of PGPR on biochemical changes during different stages of coriander (Coriandrum sativum L.) seedlings
Warwate Sunil I. (J4-01435-2014)
Dr. U. K. Kandoliya
Year 2017-18
7.
Biochemical changes in groundnut (Arachis hypogaea L.) In response to stem rot (Sclerotium rolfsii) infection
Pipaliya Hardik R. (2010115062)
Dr. G. V. Maraviya
8.
Biochemical characterization for induced systemic resistance by Psedomonas antagonists against Alternaria Blight in cumin
Italiya Chirag J. (2010115034)
Dr. S. V. Patel
9.
Biochemical characterization for induced systemic resistance by Bacillus antagonists against Fusarium wilt in cumin
Kalaria Hiren S. (2010115040)
Dr. H. P. Gajera
Year 2018-19
10.
Biochemical changes influenced by nanoparticles treatments in germinating coriander (Coriandrum sativum L.)
Desai Niralben R. (2010116029)
Dr. S. V. Patel
11.
Effect of exogenous application of salicylic acid on green gram (Vigna radiate (L.) wilczek) irrigated with saline water
Trivedi Sandhyaben K. (2010116123)
Dr. U. K. Kandoliya
12.
Effect of exogenous application of salicylic acid on black gram (Vigna mungo (L.) Hepper) irrigated with saline water
Solanki Mitalben V. (2010115086)
Dr. U. K. Kandoliya
13.
Metabolomics and morphological characterization of macroalgae
Parmar Krupalkumar A. (2010116087)
Dr. P. J. Rathod
Year 2019-20
14.
Response of biochemical changes of thiourea application in wheat (Triticum aestivum L.) under water deficit stress
Guna Gautam D. (2010116043)
Dr. M. K. Mandavia
15.
Effect of salicylic acid on biochemical and physiological changes in pigeon pea (Cajanus cajan L.) in response to saline water stress
Bhuva  Jaykumar V.  (2010117020)
Dr. G. V. Maraviya
16.
Effect of seed priming of pearl millet (Pennisetum glacum L.) with salicylic acid on physiological and biochemical changes under salinity stress
Parmar Shraddhaben R. (2010117087)
Dr. M. K. Mandavia
17.
Effect of gibbrellic acid, Potassium nitrate and silicic acid on biochemical changes in cowpea (Vigna unguiculata L.Walp) seedling irrigated with saline water
Patel Riddhi S. (2010117099)
Dr. U. K. Kandoliya
18.
Effect of salicylic acid on biochemical and physiological changes in pigeon pea (Cajanus cajan L.) in response to water stress
Rakholiya Kishankumar P. (2010117110)
Dr. G. V. Maraviya
19.
Effect of gibbrellic acid, Potassium nitrate and silicic acid on biochemical changes in Groundnut (Arachis hypogaea L.) seedling irrigated with saline water
Purohit Harsh B. (2010117106)
Dr. U. K. Kandoliya
20.
Physiological and biochemical characterization of prickly pear accessions
Kadam Dipak D. (2010117055)
Dr. S.S. Sapre
21.
Biochemical changes influenced by nanoparticles tratments in germinating chilli (Capsicum annuum L.)
Parmar Bhavnaben R. (2010117085)
Dr. H.P.Gajera
Year 2020-21
22.
Biochemical changes influenced by nanoparticles treatments in  germinating cumin (Cuminum cyminum L.)
Thummar Khushbu  A. (2010118102)
Dr. H. P. Gajera
23.
Effect of growth regulators on physiological and biochemical changes in mothbean (Vigna aconitifolia Jacq.) irrigated with saline water

Shaikh Kaniz A.Fatema Samsuddeenbhai

(2010118089)

Dr. U. K. Kandoliya

24.
Effect of salicylic acid on biochemical and physiological changes in maize   (Zea mays L.) in response to water stress

Talavia Shrutiben Mahendrakumar

(2010118099)

Dr. G. V. Marviya

25.
Biochemical aspect of processing in different millets

Patoliya Hinal Pravinbhai (2010118082)

Dr. S. S. Sapre

26. Effect of growth regulators on physiological and biochemical changes in chickpea (Cicer arietinum L.) irrigated with saline water

Varun Y D (2010118111)

Dr.U. K. Kandoliya

Year 2021-22
27. Biochemical changes in resistant and Susceptible Genotypes of Castor (Ricinus communis L.) in Response to Wilt (Fusarium oxysporum f.sp.ricini )Disease

Marakana Ravikumar Devjibhai

(2010118059)

Dr. G. V. Marviya

Dr. A. G. Vala
28. Effect of edible coating on biochemical changes in guava fruit (Psidium guajava l.) during storage

Makadiya Dhruvinkumar D.

(2010119059)

Dr. S. S. Sapre

29. Biochemical and minerals profiling of peanut (Arachis hypogaea L.) genotypes

Varu Harsh Punjabhai

(2010119117)

Dr. P. J. Rathod

30. Decoding of phytochemicals and bioactive compounds of some medicinal plants growth in saurashtra region

Umamaheshwar Y (2010119107)

Dr. P. J. Rathod

31. Assessment of diversity in brinjal (Solanum melongena L.) fruit colour through biochemical and metabolic traits

Ram Mayurkumar L. (2010118084)

Dr. P. J. Rathod

32. Influence of salinity stress and seed priming on biochemical aspects of wheat (Triticum aestivum L.)seedling

Patel Shreya S. (2010119084)

Dr. G.V.Marviya

33.

Biochemical changes influenced by nanoparticle treatments during fusarium wilt infection in castor (ricinus communis L.)

Chovatiya Nirbhay C. (2010119020)

Dr. H.P.Gajera

34. Biochemical changes in pearl millet flour during storage.

Ninama Sandhyadevi S. (2010119076)

Dr. S. S. Sapre

35. Effect of roasting and storage on nutritional quality of groundnut (Arachis hypogaea L.)kernels.

Mahla Nitignakumari S. (2010119057)

Dr. M.K.Mahatma

Year 2022-23
36.

Protein and fatty acid profiling of spreading, semi spreading and bunch types varieties of groundnut (arachis hypogaea l.)

Gore Vishnu Baparao  (2010120033)

Dr. P.J.Rathod

37.

Effect of different polysaccharide based edible coatings on shelf life of tomato

(Lycopersicon esculentum L.)

Sondarva Rutvik Pravinbhai (2010120083)

Dr. S. S. Sapre

38. Effect of seed priming on biochemical parameters under water stress in chickpea (cicer arietinum l.)

Pansara Parthkumar Naranbhai (2010120064)

Dr. G.V.Marviya

39. Effect of nanoparticles on physiological and biochemical parameters under water stress in wheat (triticum aestivum L.)

Gulla Bhavitha (2010120034)

Dr. G.V.Marviya

Year 2023-24
40.
Effect of different agricultural waste on growth, yield and nutritional composition of oyster mushroom (pleurotus ostreatus)
Akola Riddhi Kantibhai (2010121001)
Dr. S.S. Sapre
41.
Effect of growth regulators on physiological and biochemical changes in pearl millet [Pennisetum glaucum (l.) r. br.] irrigated with saline water
Kundan (2010121076)
Dr. G.V.Maravia
Year 2024-25
42.
Morphological and phytochemical depiction of tomato fruits at green and red ripen stages
Sarvaiya Purvisha Nileshbhai (2010122062)
Dr. P.J.Rathod
43.
Biochemical and morpho-physiological changes in fenugreek (trigonella foenum-graecum L.) in response to salinity
Bhut Jayesh Morarjibhai (2010122009)
Dr. S. S. Sapre
44.
Effect of plant growth regulators on physiological and biochemical parameters of indian mustard [Brassica juncea (L.) czern and coss.] under irrigation of saline water
Vadhel Hiteshkumar Jitubhai (2010120097)
Dr. U. K. Kandoliya
Ph.D. Theses Submitted
Sr. No.
Title of the thesis
Name of the student
Name of guide
Plant Molecular Biology and Biotechnology
Year 2015-16
1.
De novo transcriptome sequencing to discover putative genes associated with drought tolerance and their expression in pearl millet (Pennisetum glaucum l.)
Anatala Tusharkumar  J. ( J4-01016-2012
Dr. M. K. Mandavia
2.
Molecular   and biochemical   characterization of drought tolerant endophytic bacteria  isolated from wildpoaceae  family  plants
Akbari Disheeta L. (J4-00794-2011)
Dr. B. A. Golakiya
3.
Molecular   and biochemical   characterization of salt tolerant endophytic bacteria  isolated from wild malvaceae  family  plants
Bhadania Roshani A. (J4-01021-2012)
Dr. B. A. Golakiya
4.
Gene expression study of host pathogen interaction during papaya ring spot virus infection in papaya (Carica papaya L.)
Pritesh Hargovindbhai Sabara
(J4-00523-2009)
Dr. D. N. Vakharia
5.
Whole genome sequencing of sesame (Sesamum indicum L.) cv. guj. til-10 using next-generation sequencer"
Vaja Mahesh B. (J4-00686-2010)
Dr. B. A. Golakiya
Year 2016-17
6.
Interspecific protoplast fusion between Trichoderma harzianum and Trichoderma viride for biocontrol improvement
Lakhani Hardik N. (J4-00641-2010)
Dr. D. N. Vakharia
7.
Molecular characterization of Psedomonas for biocontrol activity in phytopathogen systems
Vaja Komalben N. (J4-01200-2013)                           
Dr. H. P. Gajera
Year 2017-18
8.
Molecular characterization of aflatoxin producing  aspergillus  in groundnut and their remedies with bacterial nanoparticles 
Bharose Achyut A. (J4-01345-2014)                            
Dr. H. P. Gajera
9.
Transcriptome Profiling of chickpea (Cicer arietinum L.) with relation to wilt disease (Fusarium oxysporum f. sp. Ciceri)
Jasminkumar Vanmalibhai Kheni
(J4-01151-2013)                            
Dr. B. A. Golakiya
10.
Characterization of transgenic groundnut (Arachis hypogaea L.) expressing the ZAT12 transcription factor gene under abiotic stresses
Abhay Kumar (J4-01014-2012
Dr. T. Radhakrishnan
11.
Transcriptome dynamics and biochemical appraisal of Arachis hypogaea ssp. virginia bunch during flower development
Umretiya Nimita G. (J4-01423-2014)
Dr. B. A. Golakiya
12.
Isolation, antagonism and genome characterization of aflatoxigenic and atoxigenic Aspergillus
Jayeshkumar Harjibhai Kahodariya
(J4-00627-2010)
Dr. H. P. Gajera
13.
Transcriptome analysis of wheat (Triticum aestivum L. Em. Thell) under heat stress at booting stage
Nandha Abhijeeta K. (J4-01389-2014)
Dr. D. R. Mehta
14.
Genome and transcriptome sequencing of coriander (Coriandrum sativum L.) to reveal its genome architecture
Tulsani Nilam J. (J4-01422-2014)
Dr. B. A. Golakiya
15.
Linkage and QTL mapping for blast resistance in pearl millet (Pennisetum glaucum (L.) R. Br.
Sanghani Jayeshkumar M.
(J4-01187-2013)
Dr. B. A. Golakiya
Year 2018-19
16.
Insilico identification and target prediction of microRNAs and their expression profiling in Sesamum indicum L.
Joshi Halakben Vibhakarbhai Minaxiben
(J4-01154-2013)
Dr. M. K. Mandavia
17.
micro RNA profiling, antifungal and nanoformulation characterization of multi stress tolerant Trichoderma fusants for biocontrol activity against Sclerotium rolfsii sacc. causing stem rot in Groundnut
Hirpara Darshna G. (1010115007)
Dr. H. P. Gajera
18.
Construction of linkage mapping and identification of quantitative trait loci (QTL) for earliness, grain size and leaf rust resistance in bread wheat (Triticum aestivum L.)
Delvadiya Niravkumar A.
(J4-01137-2013)
Dr. D. R. Mehta
19.
De novo transcriptome sequencing and metabolom analysis at flowering stage in off season bearing Mango (Mangifera indica L.)
Desai Hiralben V. (J4-01357-2014)
Dr. M. K. Mandavia
20.
Molecular analysis of transgenic groundnut (Arachis hypogaea L.) expressing the transcription factor DREB1A driven by an inducible promoter under drought stress
Bhalani Hiren N. (J4-01022-2012)
Dr. Radhakrishnan T.
Year 2019-20
21.
Mapping and validation of SSR markers associated with foliar-fungal disease resistance QTLs and development of RILs in groundnut(Arachis hypogaea L.)
Suhail Ahmed A. Hakeem. (J4-01418-2014).
 
Dr. H. P. Gajera
22.
Transcriptome and hormone profiling of sesame (Sesamum indicum L.) during interaction with macrophomina phaseolina.
Radadiya Nidhi G. (101015013)
Dr.B.A. Golakiya
Year 2020-21
23.
Molecular approach for development of potential beauveria based nano -biopesticide to control infection of sucking pest.
Bhadani Rushita V. (1010117002)
Dr. H. P. Gajera
24.
Transcriptome &Metabolic profiling in response to fusarium wilt in castor (Ricinus communis L.)
Kachhadiya Harshita J. (1010117009)
Dr. D. R.Mehta
25.

Comparative transcriptome and metabolomics profiling of aflatoxin resistant and susceptible groundnut influenced by toxigenic and non-toxigenic Aspergillus flavus

Antala Virali G. 1010116001

Dr. B. A. Golakiya

26. Transcriptome sequencing and metabolomic characterization of barnyard millet (Echinochloa frumentacea L.) to discover putative genes involved in spike development and its neutraceutical properties flavus

Padhiyar Shitalben M. (1010117014)

Dr. R. S. Tomar

27. Utilizing groundnut (Arachis hypogaea L.) rhizosphere microbiome for biological control of dry root rot

Parakhiya Manojkumar V. (J4-01443-2014)

Dr. B. A. Golakiya

28. Transcriptome and metabolic profiling in response to root rot (Macrophomina phaseolina)infection in mungbean [Vigna rediata (L.)Wilczek]

Dabhi Kirtibahen A. (1010116004)

Dr. H. P. Gajera

Year 2021-22
29. Comparative Transcriptome analysis of male and female flower in spine gourd (Momordica dioica)during different stages of bud formation

Vasava Divyesh K. (1010118025)

Dr. R. S. Tomar

30. CRISPR-mediated genome editing in tomato (Solanum lycopersicum Mill) for herbicide resistance

Shashikant Sharma (1010117025)

Dr. B. A. Golakiya
31. De novoTranscriptome analysis of a medicinal plant:Telosma pallida L.

Umaretiya Vidisha R. (1010118023)

Dr. D. R. Mehta

32.

Transcriptome and phytohormone profiling of groundnut (Arachis hypogaea L.) to understand the mechanism of fresh seed dormancy

Hemangini A. Chaudhary (1010117006)

Dr. M.K.Mahatma

Year 2022-23
33. Genome editing through crispr-cas 9 for improvement of oil quality in soybean(Glycine max (L.) merrill

Rathod Balaji Ulhas (1010119025)

Dr. R. S.Tomar

34. Microbiome diversity and metagenomics analysis associated with Fusarium Wilt in cumin rhizosphere

Hirani Nimisha Vinubhai (1010118011)

Dr. H.P.Gajera

35. Gene expression of castor genotype upon fungal infection (macrophomina phaseolina) and identification of disease resistant gene

Shulabhi Verma (J4-00532-2009)

Dr. B.A.Golakiya

36. De Novo transcriptome sequencing and metabolomics profiling to discover putative genes of Little Millet(panicum sumatrense L.) associated to drough tolerance

Dhawale Ramesh NarayanRao (1010119006)  

Dr. R.S.Tomar

37.

Transcriptome and biochemical changes influenced by nanosilicon under drought in germinating chickpea (cicer arietinum l.)

Hirapara Kinjalkumari Mukeshbhai

(1010119009)

Dr. H.P.Gajera

Year 2023-24
38.
Transcriptome and biochemical depictions of developing anther influenced by salicylic acid functionalized nanochitosan under heat stress in cotton (gossypium hirsutum l.)
Savani Khyati Rasikbhai (1010120023)
Dr. H.P.Gajera
39.
Differential gene expression profiling of dwarf and tall coconut (Cocos nucifera L.) genotypes using transcriptome sequencing
Savaliya Nidhi  Vinod bhai (1010120022)
Dr.  R. S. Tomar
Year 2024-25
40.
Development of salinity stress tolerant transgenic tomato (Solanum lycopersicum L.)
Likhindra Reang  (1010119016)
Dr.  D. R. Mehta
41.
Exploiting nano-scale zinc nutrition and molecular interventions to improve yield and quality of Groundnut (Arachis hypogaea L.)
Ashwini M. N.
Dr. H. P. Gajera
Biochemistry
Year 2017-18
1.
Biochemical and molecular basis of innate and Pseudomonas flurescence induced stem rot tolerance in groundnut (Arachis hypogeae L.)                  
Sujit Kumar Bishi (J4-01084-2012)
Dr. D. N. Vakharia
2.
Transcriptomic and metabolomic analysis of groundnut (Arachis hypogaea L.) under varying temperature
Raval Sacheenkumar S. (J4-01183-2013)
Dr. M. K. Mahatma
3.
Biochemical and molecular changes in Pearl Millet (Pennisetum glaucum L.) genotypes subjected to short term water stress and its revival
Deshmukh Shubham Babanrao
( J4-01028-2012)
Dr. M. K. Mandavia
Year 2018-19
4.
Isolation, separation, identification and characterization of an active ingredients from anticancer medicinal plants
Joshi Kavita B. (J4-01155-2013)
Dr. M. K. Mandavia
5.
Isolation, separation and identification of active ingredients from antidiabetic medicinal plants
Timbadiya Priyanka N. (J4-01421-2014)
Dr. M. K. Mandavia
Year 2019-20
6.
Biochemical and molecular analysis in pearl millet (Pennisetum glaucum L.) genotypes under heat stress during flowering stage
Ukani Piyush K. (1010116019)
 
Dr. M. K. Mandavia
Year 2020-21
7.
Biochemical and molecular characterization of chickpea (Cicer arietinum L.)under heat stress
Pipaliya Hardik R. (1010117017)
Dr. H.P.Gajera
Year 2021-22
8.

Biochemical changes influenced by silicon and nano-silicon during salt stress in chickpea (Cicer arietinum L.)

Trivedi Sandhya K. (1010118022)

Dr. H. P.Gajera

9. Biochemical and molecular evalution of nutritional and anti -nutritional compounds in groundnut kernals at various pod developing stages during moisture deficit condition.

Solanki Mitalben V. (1010118021)

Dr. M.K.Mahatma

Year 2022-23
10. Biochemical changes influenced by nano-silicon under salinity in  germinating seeds of Groundnut (Arachis hypogaea L.)

Purohit Harsh Bharatbhai (1010119024)

Dr. H.P.Gajera

Year 2023-24
11.

Deciphering the efficacy of iron oxide nanoparticles to mitigate nutritional requirement in groundnut

Smrutirekha Sahu (1010120024)

Dr. U.K.Kandoliya

12. Ameliorating effect of gibberellic acid, abscisic acid and salicylic acid on changes in physio biochemical composition and oxidative enzymes in wheat (Triticum aestivum L.) irrigated with saline water

Patoliya Hinal Pravinbhai (1010120019)

Dr. U. K. Kandoliya
13. Biochemical changes influenced by nano-silicon under salinity in seedlings of green gram (Vigna radiata (L.) r. wilczek)

Chovatiya Nirbhay Chimanbhai (1010121002)

Dr. U. K. Kandoliya
Year 2024-25
14. NIL    
Faculty Participated in Trainings/Refresher Course/Summer/Winter School etc.
Sr. No.
Name of Faculty
Period
Nature of Training
Place
From
To
 
 
Year 2015-16
1.     
Dr. V. B. Rathod
20/07/2015
16/08/2015
Orientation programme
UGC: HRDC, Saurashtra university, Rajkot, Gujarat (India).
2.     
Dr. P. J. Rathod
 
20/07/2015
16/08/2015
Orientation programme
UGC: HRDC, Saurashtra university, Rajkot, Gujarat (India).
3.     
Dr. U. K. Kandoliya
20/07/2015
16/08/2015
Orientation programme
UGC: HRDC, Saurashtra university, Rajkot, Gujarat (India).
4.     
Dr. R.S. Tomar
06/05/2015
26/05/2015
Winter school on RNA-interference as a tool for Plant functional genomics and crop improvement
ICAR-NRCPB, New Delhi.
5.     
Dr. M. V. Parakhia
06/05/2015
26/05/2015
Winter school on RNA-interference as a tool for Plant functional genomics and crop improvement
ICAR-NRCPB, New Delhi.
6.     
Dr. A. G. Vala
18/05/2015
02/06/2015
Summer training on plant tissue culture
Plant tissue culture laboratory, Anand Agricultural University, Anand.
Year 2016-17
1.     
Dr. S. B. Bhatt
02/02/2016
07/02/2016
Food and Feed safety of GM crops
National institute of Nutrition, Hyderabad
2.     
Dr. S. B. Bhatt
22/12/2016
23/12/2016
Leadership and Entrepreneruship Development
JAU, Junagadh.
3.     
Mr . V. G. Vyas
16/04/2016
19/04/2016
lab management & Internal Audit (NABL
STQC directorate CETE –Pune
Year 2017-18
4.     
Dr. H. P. Gajera
16/01/2018
25/01/2018
Techniques for estimation of nutraceutical properties from crops
Dept of Biochemistry, AAU, Anand during 16-25 January, 2018.
5.     
Dr. U. K. Kandoliya,       
Dr. G. V. Marviya           
Dr. P. J  Rathod,
Prof. V. B., Rathod             
Dr. S. B. Bhatt
04/09/2017
24/09/2017
Genomic, Proteomic and Metabolomic Application in crop Improvement
Department of Biotechnology, JAU, Junagadh
Year 2018-19
1.     
Dr. A. G. Vala
24/09/2018
26/09/2018
3-day workshop on transgenic trait detection in crops
Dept of Biotechnology, JAU, Junagadh
2.     
Dr. A. G. Vala
1/09/2018
21/09/2018
21-day training on Comparative genomics of horticultural plants genetic resources
UAS, Bangalore
3.     
Dr. A. G. Vala
22/10/2018
23/10/2018
2-day workshop on recent advance in tools for genetic studies
Dept of Biotechnology, JAU, Junagadh
Year 2019-20
1.
Dr. Rukam S. Tomar
14/10/2019
25/10/2019
International Hands-on Training on Genome Editing Technologies
Asia-Pacific Association of Agricultural Research Institutions (APAARI) at ICRISAT, Hyderabad
2.
Dr. A. G. Vala
06/02/2019
26/02/2019
21-days Winter School
Assam Agricultural University, Barbheta, Jorhat, Assam, India
Year 2021-22
1.
Dr. H. P. Gajera
Dr. M. V. Parakhia
09/08/2021
13/08/2021
"Pesticide Residues in Food and Environmental Samples"
jointly organized by Agilent University and Food Testing Laboratory, JAU, Junagadh
2.
Dr.P.J Rathod
12/07/2021 
14/07/2021
Three days International Training prograamme on Biofortification: key to nutritional Security
MANAGE Hyderabad and Hravest plus,USA
Year 2023-24
1.
Dr.A. G. Vala
07/02/2024
27/02/2024
21-days Winter School
ICAR-National Institute for Plant Biotechnology New Delhi
2.
Dr. S. B. Bhatt
20/11/2023
10/12/2023
21 days international training on "Agriculture in Future and Future in Agriculture"
JAU Junagadh
3.
Dr. Y. V. Naghera
20/11/2023
10/12/2023
21 days international Training on "Agriculture in Future and Future in Agriculture"
JAU Junagadh (Hybrid mode)
Year 2024-25
1.
Dr. S. B. Bhatt
01/03/2025
30/03/2025
30 days International Winter school cum training program Novel Approaches in Agricultural Systems
JAU Junagadh (Hybrid mode)
2.
Dr. D. G. Hirpara
18/03/2025
20/03/2025
HRD Training Programme on "Digital Solution for Agricultural Technology Transfer"
Directorate of Extension Education, JAU,
Junagadh
3.
Dr. D. G. Hirpara
20/07/2024
20/07/2024
NABL Accreditation and Its Benefits
Department of Biotechnology, CoA, JAU, Junagadh
Seminar / Symposia / Workshop Attended by Faculty
Sr. No.
Name of Faculty
Period
Place
Title
From
to
Year 2015-16
1.     
Dr. S. B. Bhatt
21/02/2016
28/02/2016
National institute of nutrition, Hyderabad, Telangana.
Food and Feed safety of  GM crops
2.     
Dr. A. G. Vala
29/06/2015
29/06/2015
Ahmedabad
Biotechnology for climate change in agriculture
3.     
Dr. A. G. Vala
11/08/2015
11/08/2015
Dept. of Biotechnology, JAU, Junagadh
Microwave Plasma Atomic Emission Spectroscopy Workshop
Year 2016-17
1.     
Dr. H. P. Gajera,
Dr. G. V. Marviya,
Dr. U. K. Kandoliya,
Ms. V. B. Rathod
06/12/2016
08/12/2016
Department  of Biochemistry, B.A.College of Agriculture,  Anand Agricultural
Nutraceuticals and Functional Foods: The Challenges andOpportunities
University, Anand-388110, INDIA
2.     
Dr. G. V. Marviya,
Dr.  U. K. Kandoliya
26/09/2016
26/09/2016
Junagadh Agricultural University, Junagadh
Technological Changes and Innovation in Pomegranate Production and Utilization for Enhancing Farmers Income
3.     
Dr. Rukam Singh Tomar
22/02/2016
23/02/2016
NASC Complex, New Delhi
Environmental Risk Assessment of Genetically Engineered Plants
4.     
Dr. S. B. Bhatt
23/12/2016
23/12/2016
Gujarat Vidyapith
Pashupalan and Sajivkheti
Year 2017-18
 
Dr. S. B. Bhatt
13/07/2017
13/07/2017
AAU, Anand
State level Biosafety Capacity Building
Year 2019-20
1.
Prof. M. V. Parakhia,
Dr. H. P. Gajera,
Dr. P. J. Rathod,
Prof. V. B. Rathod,
Dr. S. B. Bhatt
27/09/2019
27/09/2019
College of agriculture engineering and technology, JAU, Junagadh
Workshop on "Application of Nuclear energy in Agriculture and food"
2.
Dr. H. P. Gajera,
Dr. A. G. Vala,
Dr. U. K. Kandoliya,
Prof. V. B. Rathod
14/10/2019
15/10/2019
Junagadh agricultural University, Junagadh
Sensitization Workshop on “NAHEP, Component-2A: Activities and Implementation of Acadamic Management System (AMS)”
3.
Dr. H. P. Gajera,
Dr. A. G. Vala
12/12/2019
13/12/2019
Navsari Agricultural University,
Navsari
Seminar on "Biochemical and Molecular Biology Intervention for Nutritional Security and Food Safety"
Year 2021-22
1.
Dr. U. K. Kandoliya
17/06/2022
17/06/2022
Anand
Exploring and Enlighting the Significance of Nutrition and Health” Organised by Department of biochemistry, AAU
Year 2022-23
1.
Dr. M. V. Parakhia
27/06/2022
03/07/2022
Glostem and Indian Young Academy of Science
Genome editing : Basic to advance application in agriculture , Pharma and health sector
2.
Dr.P.J Rathod
16/02/2023
17/02/2023
NAHEP,IDP,ICAR worldbank Junagadh
Waste Urtilizaation and management for Energy generation 
Year 2023-2024
1.
Dr.P.J Rathod
05/06/2023
06/06/2023
NAHEP,IDP,ICAR world bank Junagadh
Use of modern technologies & Automation in food processing 
2.
Dr. H. P. Gajera
Dr. M. V. Parakhia
05/10/2023
07/10/2023
Junagadh Agricultural University, Junagadh
Workshopon NARES - Blended learning platform under NAHEP by ICAR-IASRI
3.
Dr. H. P. Gajera
Dr. M. V. Parakhia
06/06/2023
06/06/2023
Junagadh Agricultural University, Junagadh
GAAS Seminar "Modern Agricultural Practices of Coconut: Problems and Remidies"
4.
Dr. H. P. Gajera
Dr. M. V. Parakhia
04/12/2023
05/12/2023
Junagadh Agricultural University, Junagadh
Workshopon The Growing Role of Artificial Intellingence in Agriculture: Revolutionizing Farming practices under NAHEP - IDP
5.
Dr. H. P. Gajera
23/02/2024
24/02/2024
Department of Microbiology, Faculty of Science, ATMIYA UNIVERSITY, Rajkot
National Conference on “Environmental Microbiology and Regulatory Aspects
6.
Dr. U. K. Kandoliya
29/06/2024
29/06/2024
Online
‘Yoga for Mental and Physical Wellness’ organized by Education Department, Government of Gujarat, Knowledge Consortiumof Gujarat
7.
Dr. S. B. Bhatt
06/06/2023
06/06/2023
JAU, Junagadh 
State level seminar on Modern Agricultural Practices of coconut: Problems and remedies” jointly organized by GAAS and JAU,Junagadh
8.
Dr. S. B. Bhatt
05/10/2023
07/10/2023
JAU, Junagadh 
NARES Blended learning platform jointly organised by JAU and ICAR during October 05-07,2023
9.
Dr. S. B. Bhatt
24/12/2023
26/12/2023
JAU, Junagadh 
1 st International conference on Natural vs Organic farming in context to Bhartiya Agriculture organised by GNFSU and Hindustan Agricultural Research Welfare Society , IIMTU Meerut
10.
Dr. S. B. Bhatt
23/02/2024
23/02/2024
JAU, Junagadh 
Participated in the online science quiz contest held  at Nehru centre Mumbai during National science day celebration
11.
Dr. D. G. Hirpara
06/12/2023
07/12/2023
College of Horticulture, JAU, Junagadh
National Workshopon “Automation in Protected Cultivation” NAHEP – IDP, ICAR
12.
Dr. Jay M. Khaniya
12/10/2023
14/10/2023
Saputara
Transformation of Agro-Technologies for Enhancing Production under Diverse Agro-Ecosystem 
13.
Dr. Jay M. Khaniya
30/10/2023
01/11/2023
Sardarkrushinagar Dantiwada Agricultural Universtiy, Sardarkrushinagar
Pormotion of Millets (Shree Anna) for Sustainable Agriculture and Nutritional Security towards Global Prosperity: Key Challenges and Future Prospects
14.
Dr. Jay M. Khaniya
21/12/2023
24/12/2023
Science City – Ahmedabad
Bhartiya Vigyan Sammelan
Year 2024-25
1.
Dr. H. P. Gajera
28/05/2024
31/05/2024
JAU, Junagadh, Gujarat, India
Paradigm and Dynamics of Digital Horticulture for Food, Nutrition, and Entrepreneurship
2.
Dr. H. P. Gajera
20/07/2024
20/07/2024
Department of Biotechnology, CoA, JAU, Junagadh
NABL Accreditation and Its Benefits
3.
Dr. U. K. Kandoliya
11/07/2024
11/07/2024
Online (Organized by Education Department, GoG, KCG)
‘Shielding Against Monsoon Diseases Expert Advice’ organized by Education Department, GoG, KCG
4.
Dr. U. K. Kandoliya
02-08-2024
02-08-2024
Online (Organized by Education Department, GoG, KCG)
‘Leveraging Technology for Better Educational Outcomes’ 
5.
Dr. U. K. Kandoliya
11/10/2024
11/10/2024
Online (Organized by Education Department, GoG, KCG)
‘Employability Skills’  organized by Education Department, GoG, KCG
6.
Dr. Jay M. Khaniya
13/09/2024
13/09/2024
Online
Internet of Things
7.
Dr. Jay M. Khaniya
19/10/2024
19/10/2024
Education Department, GoG, KCG
Positive Attitude for Professional Excellence 
8.
Dr. Jay M. Khaniya
13/11/2024
13/11/2024
Online 
Empowering Educators in AI and IoT
Seminar/workshop/symposia organized by the Department
Sr. No.
Title
Period
Place
Organized by
From
To
Year 2015-16
1
Microwave Plasma Atomic Emission Spectroscopy Workshop
11/08/2015
11/08/2015
Food Testing Laboratory (FTL) of Department of Biotechnology, Junagadh Agricultural University, Junagadh
Department of Biotechnology, JAU in collaboration withAgilent technologies
2
Campus to Corporate Training cum Seminar
17/10/2015
17/10/2015
Food Testing Laboratory (FTL) of Department of Biotechnology, Junagadh Agricultural University, Junagadh
Department of Biotechnology, JAU in collaboration withDirectorate of Student Welfare
3
Beachell-Borlaug International Scholars Program
17/12/2015
17/12/2015
Food Testing Laboratory (FTL) of Department of Biotechnology, Junagadh Agricultural University, Junagadh
Department of Biotechnology, JAU in collaboration withMonsanto’s
Year 2016-17
1.
An insight into NGS : the ultimate companion in cutting edge research
22/04/2016
22/04/2016
Food Testing Laboratory (FTL) of Department of Biotechnology, Junagadh Agricultural University, Junagadh
Department of Biotechnology, JAU sponsored with Bioinnovation
Year 2017-18
1
Bioinformatics Tools and Analysis (CLC and IPA Genomics)
12/05/2017
12/05/2017
Food Testing Laboratory (FTL) of Department of Biotechnology, Junagadh Agricultural University, Junagadh
Department of Biotechnology, JAU, Junagadh sponsored by Qiagen
2
Recent Trends and Techniques In Genomics and Proteomics for Agriculture
12/10/2017
12/10/2017
Department of Biotechnology, Junagadh Agricultural University, Junagadh
Department of Biotechnology, JAU, Junagadh sponsored by Merck Life science
Year 2018-19
1
Transgenic trait detection in crop
24/09/2018
26/09/2018
Department of Biotechnology, Junagadh Agricultural University, Junagadh
Department of Biotechnology, JAU, Junagadh sponsored by Gujarat State Biotechnology Mission, Gandhinagar
2
Recent advances in tools for genetic studies
22/10/2018
23/10/2018
Food Testing Laboratory (FTL) of Department of Biotechnology, Junagadh Agricultural University, Junagadh
Department of Biotechnology, JAU, Junagadh sponsored by ThermoFisher Scientific
Year 2024-25
1
NABL awareness program: Soil testing recognition program titled "NABL Accreditation and Its Benefits’’
20/07/2024
20/07/2024
Department of Biotechnology, CoA, JAU, Junagadh
Jointly organized by Junagadh Agricultural University and NABL, Ahmedabad
Training organized by the Department
Sr. No.
Title
Period
Place
Nature of training
No. of Participants
From
To
Year 2015-16
1
Farmers day
09/09/2015
09/09/2015
Food Testing Laboratory (FTL) of Department of Biotechnology, Junagadh Agricultural University, Junagadh
One day training programme for farmers on Farmers Day
About 100
Year 2017-18
1
Winter School on Genomic, Proteomic and Metabolomic Application in Crop Improvement
04/09/2017
24/09/2017
Department of Biotechnology, Junagadh Agricultural University, Junagadh
Department of Biotechnology, JAU, Junagadh
30
Year 2019-20
1
Automation and Advances in Chromatography
06/09/2019
07/09/2019
Dept. of Veterinary Pharmacology and Toxicology, College of Veterinary Science and A.H., JAU, Junagadh,
and Food Testing Laboratory, JAU, Junagadh
Training on TLC, HPTLC, HPLC, LC-MS QTOF, Gas Chromatography, GC-MS QTOF and Preparative HPLC
85 U.G. Students of  Veterinary
Year 2022-23
1
Next Generation Sequencing
21/11/2022
25/11/2022
Jointaly organized by Gujarat Biotechnology Research Centre, Gandhinagar and Department of Biotechnology, JAU, Junagadh at Junagadh
Hands on trainigng on Next generation sequencing 
15
Year 2023-24
1.
Application of Next Generation DNA Sequencing Technology in Agriculture 
26/06/2023
30/06/2023
Under the IDP-NAHEP by Dept. of Biotechnology, JAU, Junagadh
A Five days Skill development training 
30 UG students
2.
NAHEP-IDP sponsored training on “Application of Next Generation DNA sequencing technology in Agriculture”
26/06/2023
30/06/2023
Department of Biotechnology, CoA, JAU, Junagadh
Five days training programme for UG students 
Around 250
Papers Published in Journals
Sr. No.
Details of Publication
NAAS Rating
Year 2015-16
1.     
Gajera, H. P.; Savaliya, D. D.; Patel, S. V. and Golakiya, B. A. (2015).Trichoderma viride induces pathogenesis related defense response against rot pathogen infection in groundnut (Arachis hypogaea L.). Infection,Genetics and Evoution, 34: 314–325.
9.26
2.     
Gajera, H. P.; Bambharolia, R. P.; Hirpara, D. G.; Patel, S. V. and Golakiya, B. A. (2015). Molecular identification and characterization of novel Hypocrea koningii associated with azo dyes decolorization and biodegradation of textile dye effluents. Process Safety and Environmental Protection, 98: 406–416.
7.83
3.     
Parmar, H. J.; Bodar, N. P.; Bhadja, N. V.; Patel, S. V.; Kandoliya, U. K. and Golakiya, B. A. (2015).  In vitro antagonism between biocontrol agent Trichoderma and pathogen Sclerotium rolfsii causing stem rot in Arachis hypogaea L. Journal of Cell and Tissue Research, 15(1): 4921-4928.
4.2
4.     
Saba, I.; Parvaze, A. S.; Kandoliya, U. K. and Baba, Z. A. (2015).  Natural variation for seed physical, biochemical,and culinary traits in common bean (Phaseolus vulgaris L.). Current Botany, 6(1): 1-8.
-
5.     
Akbari D. L.; Akbari, L. F.; Bhadania R. A.; Parkhiya, M. V. and Golakiya, B. A. (2015). Plant growth promoting traits and in vitro antagonism of drought tolerant endophytic bacteria isolated from grasses of kutch. Journal of Cell and Tissue Research, 15(3): 5241-5246.
4.38
6.     
Marviya, G. V. and Vakharia, D. N. (2015). Yield and yield attributes as influenced by terminal water stress and benzyl adenine in pearl millet [Pennisetum glaucum (L.) R. Br.] genotypes published in the proceedings of national seminar on 'Water management and climate smart agriculture' held during 13th-14th February, 2015 at Junagadh Agricultural University, Junagadh edited by  R. Subbaiah and G. V. Prajapati, 1: 182-94.
-
7.     
Chavan, R. S.; Kumar, A.; Bhatt, S. and Nalawade, T. (2015). Whey based beverage: its functionality, formulations, health benefits and applications. Journal of Food Processing and Technology,6(10): 495.
6.67
8.     
Kapadia, C. V.; Mahatma, M. K.; Parekh, M. J.; Patel, N. and Tomar, R. S. 2015. Identification of resistance gene analogs (RGAS) from highly wilt resistant castor (Ricinus Communis L.) genotype. Research Journal of Biotechnology, 10(5): 16-26.
6.26
9.     
Das, T.; Mandavia, M. K. and Mandavia, C. K. (2015). Alterations in biochemical responses and antioxidant enzymes in wheat (Triticum aestivum L.) genotypes under NaCl Salinity Stress. Indian Journal of Agricultural Biochemistry, 28(1): 57- 60.
4.02
10. 
Sanghani, J. M.; Mandavia, M. K.; Sanghani, A. O.; Raval, S. S. and Golakiya, B. A. (2015).   Analysis of genetic diversity among mungbean (Vigna radiata L.) genotypes through different Biochemical markers. Indian Journal of Agrilcultural Biochemistry, 28(1): 24-28.
4.03
11. 
Patel, S. V.; Mandavia, M. K. and Golakiya, B. A. (2015). Assessment of genetic diversity among groundnut(Arachis hypogaea L.) genotypes using molecular markers, Indian Journal of Agricultural Biochemistry, 28(1): 70-76.
4.03
12. 
Raval, S. S.; Mandavia, M. K.; Sanghani, J. M.; Mahatma, M. K. and Golakiya, B. A. (2015). Separation and identification of phytochemicals from Rscoea procera wall. Indian Journal of Agricultural Biochemistry, 28(2): 143-149.
4.03
13. 
Das, T.; Meena, M.; Mandavia, M. K. and Sapre, S. S. (2015). Influence of NACL salt stress on physiological, biochemical and isoenzyme pattern in Wheat genotypes. Research in Environent and Life Science, 8(4): 825-828.
4.25
14. 
Thummar. V. D.; Tomar, R. S.; Parakhia, M. V.; Padhiyar, S. M. and Rathod, P. J. (2015). Detection of genetic variation in tissue culture clones of date palm using ISSR markers, International Journal of Scientific Research and Development, 3(10): 37-40.
-
15. 
Dhingani, R. M.; Umrania, V. V.; Tomar, R. S.; Parakhia, M. V. and Golakiya, B. A. (2015). Introduction to QTL mapping in plants. An Plant Science, 4(04): 1072-1079.
-
16. 
Kandoliya, U. K.and Vakharia, D. N. (2015). Ascorbic acid and ascorbate peroxidase based defense system induced by Pseudomonas fluorescens against wilt pathogen in chickpea. International Journal of Plant Protection, 8(1): 86-92.
3.3
17. 
Kandoliya, U. K.; Bajaniya, V. K.; Bhadja, N. V.; Bodar, N. P. and Golakiya, B. A. (2015). Antioxidant and nutritional components of egg plant (solanum melongena L) fruit grown in Saurastra region. Intenational Journal of Current Microbiology and Applied Science, 4(2): 806-813. (ISSN: 2319-7706).
-
18. 
Kandoliya U. K.; Bodar, N. P.; Bajaniya, V. K.; Bhadja N. V. and Golakiya B. A. (2015). Determination of nutritional value and antioxidant from bulbs of different onion (Allium cepa) variety: A comparative study. Intenational Journal of Current Microbiology and Applied Science, 4(1): 635-641. (ISSN: 2319-7706).
-
19. 
Bajaniya, V. K.; Kandoliya, U. K.; Bodar, N. P.; Bhadja, N. V. and Golakiya, B. A. (2015). Phytochemical characterization of Butea monosperma seed oil. International Journal of Current Research Academic Review, 3(5): 282-287.(ISSN 2347 - 3215)
-
20. 
Patel, N. J.; Kandoliya, U. K. and Talati, J. G. (2015). Induction of phenol and defense-related enzymes during wilt (Fusarium udum Butler) infestation in pigeon pea. Intenational Journal of Current Microbiology and Applied Science, 4(2): 291-299. (ISSN: 2319-7706).
-
21. 
Bajaniya, V. K.; Kandoliya, U. K.; Bodar, N. H.; Bhadja, N. V. and Golakiya, B. A. (2015).  Fatty acid profile and phytochemical characterization of bael seed (Aegle marmelos L.) oil. Intenational Journal of Current Microbiology and Applied Science, 4(2): 97-102. (ISSN: 2319-7706).
-
22. 
Vyas, V. G.; Kandoliya, U. K.; Vidhani, S. I.; Parmar, H. J.; Bhalani, V. M. and Golakiya, B. A. (2015).Heavy metal deposition and Phytochemical characterization of curry leaves (Murraya koenigii).Intenational Journal of Current Microbiology and Applied Science, 4(10): 839-843.
-
23. 
Kandoliya, U. K.; Marviya, G. V.; Patel N. J.; Vakharia D. N. and Golakiya, B. A. (2015). Effect of drought at different growth stage on carbohydrates and lipids composition of groundnut (Arachis hypogaea L.) pod. International Journal of Current Research Academic Review, 3(10): 281-287.
-
24. 
Chavan, R S.; Kumar, A. and Bhatt, S. (2015). Tomato soup premix base: development and optimization using response surface methodology. International Journal of Engineering Research, 3(1): 35-48.
6.07
25. 
Rathod, P. J.; Vakharia, D. N.; Patel, S. V. and Golakiya, B. A. (2015). Trends in antioxidant enzymes pattern of chickpea grown in healthy plot and sick plot contaminated with wilt disease. International Journal of Scientific Research and Development, 3(9): 222-26.
IF:2.49
26. 
Vaja, M. B.; Rathod, P. J.; Mandavia, M. K. and Golakia, B. A.(2015). Genetic purity and diversity in isoenzyme Peroxidase of pearl millet hybrids. Asian Journal of Biological Science, 10(21): 153-157.
3.75
27. 
Gevariya, S. N.; Gajera, H. P.; Savaliya, D. D. and Golakiya, B. A. (2015). Phytochemical screening and antioxidant activity of Syzygium cumini L. fruit extracts. Indian Journal of Agricultural. Biochemistry, 28(1): 65-69.
4.03
28. 
Anatala, T. J.; Mandavia, M. K.; Dave, R. A.; Kothari, V. V.; Gajera, H. P.; Ramani, H. R.; Patel, S. V. and Golakiya, B. A. (2015). Protein profile and isoenzymes in response to water stress in pearl millet. Journal of Cell and Tissue Research, 15(3): 5255-5266.
4.38
29. 
Parmar, K.; Tomar, R. S.; Parakhia, M. V.; Malviya. B. J.; Rathod, V. M.; Bhatt, A. J.; Bhalara, R. B. and Golakiya, B. A. (2015). Molecular characterization of chloropyrifos degrading bacteria and gene, Journal of Cell and Tissue Research, 15(3): 5233-5239.
4.38
30. 
Anatala, T. J.; Gajera, H. P.; Mandavia, M. K.; Dave, R. A.; Kothari, V. V. and Golakiya, B. A. (2015). Leaf proteome alterations in tolerant pearl millet. International Journal of Agriculture, Environmnt and Biotechnology, 8(3): 539-549.
4.10
31. 
Gajera, H. P.; Savaliya, D. D.; Patel, S. V. and Golakiya, B. A. (2015). Lipoxygenase-related defense response induced by Trichoderma viride against Aspergillus niger Van Tieghem, inciting collar rot in groundnut(Arachis hypogaea L.). Phytoparasitica, 43: 229–240.
6.68
32. 
Sodha, K. H.; Jadav, J. K.; Gajera, H. P. and Rathod, K. J. (2015). Characterization of silver nanoparticles synthesized by different chemical reduction methods. International Journal of Pharma and Bio Science, 6(4): 199 - 208.
-
33. 
Rathod, R. R.; Mehta, D. R.; Gajera, H. P. and Delvadiya, N. A. (2015). Molecular characterization of ridge gourd (Luffa acutangulaL.) and sponge gourd (Luffa cylindrica L.) genotypes through PCR based molecular markers. International Journal of Agriculture, Environmnt and Biotechnology, 8(3): 521-530.
4.10
34. 
Tomar, R. S.;  Parakhia, M. V.; Rathod, V. M.; Kheni, J. V.; Thakkar, J. R.; Thummar, V. D.; Padhiyar, S. M. and Golakiya B. A. (2015). Development of Inter Simple Sequence Repeat based SCAR marker for sex determination in Carica papaya, Research Journal of Biotechnology, 10(12): 91-97.
6.28
35. 
Bhadania, R. A.; Golakiya, B. A.; Akabari, D. L.; Parakhia, M.V. and Bhalani, H. N. (2015). Draft genome sequence of the Endophytic Bacterium Providencia rettgeri MR4 isolated from Abuliton indicum-A Tolerant Plant.  Journal of Pure and Applied Microbiology, 9(3): 1-15.
6.00
36. 
Tomar, R. S.; Parakhia, M. V.; Thakkar, J. R.; Rathod, V. M.; Padhiyar, S. M.; Thummar, V. D.; Dalal, H.; Kothari, V. V.; Kheni, J. V.; Dhingani, R. M. and Golakiya, B. A. (2016).  Development of linkage map and identification of QTLs responsible for fusarium wilt resistance in castor (Ricinus communis L.), Research Journal of Biotechnology, 11(5): 67-73.
6.28
37. 
Malviya, B. J.;Jadeja, V. J.; Sherathiya, H. M.; Parakhia, M. V.; Tomar, R. S.; Vaja, M. B. and Sherathia, D. N. (2016). Bioremediation of glyphosate by bacteria isolated from glyphosate contaminated soil, Journal of Pure and Applied Microbiology, 9(4): 1-5.
6.00
38. 
Yusufzai, S. I.; Padhiyar, S. M.; Lende, S.,; Tomar R. S.; Thummar, V. D.; Thakkar, J. R.; Rathod V. M.; Kheni J. V.; Kothari V.; Parakhia M. V. and Golakiya B. A. (2016). Genetic diversity analysis in some marine fish species of Gujarat coast through morphological and molecular markers, Research Journal of Biotechnology, 11(3): 77-84.
6.28
Year 2016-17
1.     
Gajera, H. P.; Hirpara, D. G.; Katakpara, Z. A.; Patel, S. V.; Golakiya, B. A. (2016). Molecular evolution and phylogenetic analysis of biocontrol genes acquired from SCoT polymorphism of mycoparasitic Trichoderma koningii inhibiting phytopathogen Rhizoctonia solani Kuhn. Infection, Genetics and Evolution, 45: 383–392. DOI: http://dx.doi.org/10.1016/j.meegid.2016.09.026.
9.02
(Elsevier)
IF: 2.591
2.     
Hirpara, D. G.; Gajera, H. P.;   Bhimani, R. D. and Golakiya, B. A. (2016). The SRAP based molecular diversity related to antifungal and antioxidant bioactive constituents for biocontrol potentials of Trichoderma against Sclerotium rolfsii Scc. Current Genetics, 62: 619–641. DOI 10.1007/s00294-016-0567-5.
8.68
(Springer)
IF: 2.682
3.     
Gajera, H. P.; Katakpara, Z. A.; Patel, S. V. and Golakiya B. A. (2016). Antioxidant defense response induced by Trichoderma viride against Aspergillus niger Van Tieghem causing collar rot in groundnut (Arachis hypogaea L.). Microbial Pathogenesis,91: 26-34. DOI: http://dx.doi.org/10.1016/j.micpath.2015.11.010p.
7.79
(Elsevier)
IF: 2.00
4.     
Tomar, R. S.; Parakhia, M. V.; Rathod, V. M.; Thakkar, J. R.; Padhiyar, S. M.; Thummar, V. D.; Dalal, H.; Kothari, V. V.; Kheni, J.; Dhingani, R. M.; Sabara, P. H. and Golakiya, B. A. (2016). Molecular mapping and identification of QTLs responsible for charcoal rot resistance in Castor (Ricinus communis L.). IndustrialCrops and Products, 95: 184–190.
9.45
5.     
Vaja, K. N.; Gajera, H. P.; Katakpara, Z. A.; Patel, S. V. and Golakiya, B. A. (2016). Biochemical indices and RAPD markers for salt tolerance in wheat genotypes. Indian Journal of Plant Physiology, 21(2): 143–150. (DOI 10.1007/s40502-016-0215-6).
4.66
6.     
Katakpara, Z. A.; Gajera, H. P.; Vaja, K. N.; Dabhi, K. H. and Golakiya, B. A. (2016). Evaluation of heat tolerance indices in bread wheat (Triticum aestivum L.) genotypes based on physiological, biochemical and molecular markers. Indian Journal of Plant Physiology,  21(2): 197–207. (DOI10.1007/s40502-016-0222-7).
4.66
7.     
Thumar, S. T.; Gajera, H. P.; Dhaduk, H. L. and Sakure, A. A. (2016). Physiological, Qualitative and Molecular Markers Based Evaluation of Mango Cultivars. Indian Journal of Agricultural Biochemistry, 29(1): 80-86.
4.03
8.     
Marviya, G. V. and Vakharia, D. N. (2016). Effect of Terminal Water Stress and Benzyl Adenine on Osmoregulants in Pearl Millet [Pennisetum glaucum (L.) R.Br.]  Genotypes. Indian Journal of Agricultural Biochemistry, 29(1): 9-16.
4.03
9.     
Kandoliya, U. K.; Marviya, G. V.; Bodar, N. P.; Bhadja, N. V. and Golakiya, B. A. (2016). Nutritional and Antioxidant Components of  Ridge Gourd (Luffa acutangula L. Roxb) Fruits of Promising Genotypes and Varieties., Scholar Journal of Agriculture and Veterinary Science, 3(5): 397-401.  (eISSN:2348-1854, pISSN 2348-8883)
-
10. 
Tomar, R. S.; Parakhia, M. V., Thakkar, J. R.; Rathod, V. M.; Kothari, V. V.; Acharya, R. R. and Golakiya, B. A. (2016). Assessment of genetic variability among Muskmelon (Cucumis melo L.) genotypes through biometrical trait sand molecular markers. Electronic Journal of Plant Breeding, 11(5): 215-225.
5.00
11. 
Tomar, R. S.; Parakhia, M. V.; Thakkar, J. R.; Rathod, V. M.; Padhiyar, S. M.; Thummar, V. D.; Dalal, H.; Kothari, V. V.; Kheni, J. V.; Dhingani, R. M. and Golakiya, B. A. (2016). Development of linkage map and identification of QTLs responsible for fusarium wilt resistance in castor (Ricinus communis L.).Research Journal of Biotechnology, 11(5): 67-73.
6.24
12. 
Yusufzai, S. I.; Padhiyar, S. M.; Lende S.; Tomar, R. S.; Thummar, V. D.; Thakkar, J. R.; Rathod, V. M.; Kheni, J. V.; Kothari, V.; Parakhia, M. V. and Golakiya, B. A. (2016). Genetic Diversity Analysis in Some Marine Fish Species of Gujarat Coast through Morphological and Molecular Markers. Research Journal of Biotechnology, 11(3): 77-84.
6.24
13. 
Parakhia, M. V.; Tomar, R. S.; Vala, A. G.; Rathod, V. M. and Kheni, J. V. (2016). Whole Genome Sequencing of Drought Stress Tolerance Endophytic Bacterium Enterobacter sp. Mr1. Journal of Bacterial Mycology, 3(2): 55-58.  DOI: 10.15406/jbmoa.2016.03.00055.
-
Year 2017-18
1.     
Tomar R. S., Iquebal M. A., Parakhia M. V., Deepak Kumar, Jaiswal S., Rathod V. M., Padhiyar S. M., Neeraj Kumar, Rai A. and Dinesh Kumar (2017). Draft whole genome sequence of groundnut stem rot fungus Athelia rolfsii revealing genetic architect of its pathogenicity and virulence. Nature Scientific Reports, DOI:10.1038/s41598-017-05478-8.
11.23
2.     
Kheni J., Kothari V., Rathod K., Rathod V., Padhiyar S., Bhalara R., Tomar R. S., Parakhiya  M. V. and Golakiya B. A. (2017). Morphological and metabolic characterization of wilt disease (Fusarium oxysporum f. sp. ciceri) in chickpea (Cicer arietinum L.). Research Journal of Agriculture and Forestry Sciences, 5(7): 12-19.
7.31
3.     
Mori D. S.; Kandoliya U. K.; Bhatt V. S.; Patel S. V. and Golakiya B. A. (2017). Evaluation of Phenolics and Antioxidant Enzyme Systems for Phytophthora Blight in Resistant and Susceptible Variety of Sesame (Sesamum Indicum L.). International Journal of Current Microbiology and Applied Science, 6(8): 2344-2352.
5.38
4.     
Warwate S. I.; Kandoliya U. K.; Bhadja N. V. and Golakiya B. A. (2017). The Effect of Plant Growth Promoting Rhizobacteria (PGPR) on Biochemical Parameters of Coriander (Coriandrum sativum L.) Seedling. International Journal of Current Microbiology and Applied Science, 6(3): 1935-1944.
5.38
5.     
Warwate S. I., Kandoliya U. K., Bhadja N. V. and Golakiya, B. A. (2017). The Effect of Seed Priming with Plant Growth Promoting Rhizobacteria (PGPR) on Growth of Coriander (Coriandrum sativum L.) Seedling. International Journal of Current Microbiology and Applied Science,6(3): 1926-1934.
5.38
6.     
Rathod V. B.; Mehta D. R. and Solanki H. V. (2017). Genetic variability and divergence for oil content and yield attributes in Indian mustard [Brassica juncea (L.) Czern & Coss]. Journal of Pharmacognosy and Phytochemistry, 6(5): 1507-1509.
5.21
7.     
Kapadiya K. B.; Singh C.; Bhalara R. L.; Kandoliya U. K. and Dabhi K. H. (2017). Effect of higher temperature on leaf anatomy of heat tolerance and heat susceptible wheat genotypes (Triticum aestivum L.) by scanning electron microscopy. Journal of Pharmacognosy and Phytochemistry, 6(5), 2270-2277. 
5.21
8.     
Hirpara D. G.; Gajera* H.P.; Hirapara J. G. and Golakiya B. A. (2017). Inhibition coefficient and molecular diversity of multi stress tolerant Trichoderma as potential biocontrol agent against Sclerotium rolfsii Sacc. Infection, Genetics and Evolution, 55: 75–92. DOI: http://dx.doi.org/10.1016/j.meegid.2017.08.029
8.59
Elsevier
IF:2.885
9.     
Gajera* H.P.; Gevariya S. N.; Hirpara D. G.; Patel S. V. and Golakiya B. A. (2017). Antidiabetic and antioxidant functionality associated with phenolic constituents from fruit parts of indigenous black jamun (Syzygium cumini L.) landraces. Journal of Food Science and Technology, 54(10): 3180–3191. DOI: https://doi.org/10.1007/s13197-017-2756-8
7.24
(Springer)
IF: 2.024
10. 
Patel C. V.; Gajera* H. P.; Hirpara D. G. and Golakiya B. A. (2017). Induction of Antioxidant Enzymes and Isozymes Profile of Chickpea Genotypes Under Compatible and Incompatible Interactions with Fusarium Wilt. Journal of Plant Pathology, 99(1):131-140. DOI: http://dx.doi.org/10.4454/jpp.v99i1.3854
7.04
(Edizioni)
 
11. 
Hirpara D. G.; Gajera H. P.; Hirpara H. Z. and Golakiya B. A. (2017). Antipathy of Trichoderma against Sclerotium rolfsii Sacc.: Evaluation of Cell Wall-Degrading Enzymatic Activities and Molecular Diversity Analysis of Antagonists. Journal of Molecular Microbiology and Biotechnology, 27: 22–28.  DOI: 10.1159/000452997
7.70
(Karger)
IF: 1.701
12. 
Hirpara D. G.; Gajera H. P.; Hirpara H. Z. and Golakiya B. A. (2017). Molecular diversity and fingerprints of Trichoderma associated with antagonistic potentials against Sclerotium rolfsii Sacc. Journal of Plant Diseases and Protection, 124: 31–40. DOI 10.1007/s41348-016-0053-9.
6.68
(Springer)
IF: 0.477
13. 
Patel A. D.; Gajera H. P.; Patel S. V. and Golakiya B. A. (2017). Isolation, Identification and Molecular Characterization by RAPD of Red HE7B Dye Decolourizing Bacteria from Textile Effluents and its Cultivated Soil. Journal of Current Miocrobiology and Applied Sciences, 6(10): 1478-1484. https://doi.org/10.20546/ijcmas.2017.610.175
5.38
14. 
Patel C. V.; Ramani H. R. and Gajera H. P. (2017). Genotypic study of eighteen Chickpea (Cicer arietinum L.) against Fusarium oxysporum f.sp. ciceri with the help of STMS marker using Capillary electrophoresis and Seed storage protein profiling. Research Journal of Biotechnology, 12(7): 83-89.
6.24
15. 
Bharose A. A.; Gajera* H. P.; Hirpara D. G.; Kachhadia V. H. and Golakiya B. A. (2017). Molecular Identification and Characterization of Bacillus Antagonist to Inhibit aflatoxigenic Aspergillus flavus. International Journal of Current Miocrobiology and Applied Sciences, 6(3): 2466-2484. doi: https://doi.org/10.20546/ijcmas.2017.603.280  
5.38
16. 
Bharose A. A.; Gajera* H. P.; Hirpara D. G.; Kachhadia V. H. and Golakiya B. A. (2017). Morphological Credentials of Afla-Toxigenic and Non-Toxigenic Aspergillus Using Polyphasic Taxonomy. International Journal of Current Miocrobiology and Applied Sciences, 6(3): 2450-2465. doi: https://doi.org/10.20546/ijcmas.2017.603.279 
5.38
17. 
Kandoliya U. K.; Marviya G. V.; Rathod P. J.; Vakharia D. N. and Golakiya B. A. (2017). Pathogenesis Related Hydrolytic Enzymes Induction in Response to PGPR Seed Priming Against Wilt Pathogen (Fusarium oxysporum f. sp. ciceri) in Chickpea. Indian Journal of Agricultural Biochemistry. 30(2): 182-188.
4.1
18. 
Timbadiya P. N., Bheda S. B., Gajera H. P. and Patel S. V. (2017). Application of Peanut Butter to Improve the Nutritional Quality of Cookies. Current research in Nutrition and Food Sciences, 5(3): online ISSN: 0973-4929.
4.04
19.
Modi, K. G., Sodhaparmar, H. R., Jacob, F., & Patel, P. (2017). Use of urine and dung samples of cow and goat for biological control of phytopathogenic fungus Colletrotrichum falcatumInternational Journal of Science, Environment and Technology6(3), 1679-1684.,
3.98
Year 2018-19
1.     
Hirpara, D. G. and Gajera H. P. (2018). Molecular heterozygosity and genetic exploitations of Trichoderma inter-fusants enhancing tolerance to fungicides and mycoparasitism against Sclerotium rolfsii Sacc. Infection, Genetics and Evolution, 66: 26-36. DOI: https://doi.org/10.1016/j.meegid.2018.09.005.
8.89
Elsevier
IF: 2.885
2.     
Gajera H. P. and Hirpara D. G. (2018). Anti-hyperglycemic Effect and Regulation of Carbohydrate Metabolism by Phenolic Antioxidants of Medicinal Plants against Diabetes. Current Research in Diabetes and Obesity Journal, 5(4): 555-668. DOI: 10.19080/CRDOJ.2018.05.555668.
International
(Review)
3.     
Raval, S.; Mahatma, M. K.; Chakraborty, K.; Bishi, S. K.; Rathod, K. J.;  Jadav, J. K.; Sanghani, J. M.; Mandavia,  M. K.; Singh, A. L.; Gajera, H. P. and Golakiya, B. A. (2018). Metabolomics of groundnut (Arachis hypogaea L.) genotypes under varying temperature regimes. Plant Growth Regulation, 84: 493–505. DOI: https://doi.org/10.1007/s10725-017-0356-2
8.65
(Springer)
IF: 2.646
4.     
Gajera H. P.*, Gevariya, S. N.; Patel, S. V. and Golakiya, B. A. (2018). Nutritional profile and molecular fingerprints of indigenous black jamun (Syzygium cumini L.) landraces. Journal of Food Science and Technology, 55(2): 730-739. DOI: https://doi.org/10.1007/s13197-017-2984-y
7.26
(Springer)
IF: 1.262
5.     
Kapadia, D. A.; Gajera H. P.*, Madariya, R. B.and Golakiya, B. A. (2018). Microsatellite markers based genetic diversity in common bean (Phaseolus vulgaris L.) genotypes. Indian Journal of Biotechnology, 17: 337-345.
6.29
NISCAIR-CSIR
IF: 0.368
6.     
Bharose A. A. and Gajera H. P. (2018). Antifungal Activity and Metabolites Study of Bacillus Strain Against Aflatoxin Producing Aspergillus. Journal of Applied Microbiology and Biochemistry, 18(2): 1-8. DOI: 10.21767/2576-1412.100024
iMedPub
7.     
Dave, R. A.; Gajera, H. P.; Ukani, P. K.; Shihora, M. G.; Antala T. J., Pansuriya K. C., Timbadiya P. N. and Golakiya B. A. (2018). Evaluation of antioxidant activity, untargeted metabolite profile and elemental analysis of Euphorbia hirta L. International Journal of Chemical Studies, 6(3): 1986-1998.
5.31
8.     
Solanki,M. V.; Trivedi S. K.; Kandoliya, U. K. and Golakiya, B. A. (2018). Effect of exogenous application of salicylic acid on biochemical constituent in black gram (Vigna mungo (L.)) Hepper irrigated with saline water. European Journal of Biotechnology and Bioscience, 6(5): 28-34.
     3.21
9.     
Trivedi S. K.; Solanki M. V.; Kandoliya U. K. and Golakiya B. A. (2018). Effect of exogenous application of salicylic acid on antioxidative enzymes in green gram (Vigna radiate (L.) wilczek) irrigated with saline water. International Journal of Chemical Studies. 6(4): 2668-2674. (ISSN:  P- 2349–8528 E-ISSN: 2321–4902.)
    5.31
10. 
Solanki M. V.; Trivedi, S. K.; Kandoliya, U. K. and Golakiya, B. A. (2018). Effect of exogenous application of salicylic acid on antioxidative enzymes in black gram (Vigna mungo (L.) Hepper) irrigated with saline water.International Journal of Chemical Studies, 6(4): 2107-2116. 1591 (ISSN:  P- 2349–8528 E-ISSN: 2321–4902.)
    5.31
11. 
Bodar, N. P.; Himanshu, D. R.; Kandoliya, U. K. and Kakhani, H. (2018). Morphological characterization of isolates novel strain of Trichoderma which accumulate the heavy metal (Cobalt). International Journal of Chemical Studies, 6(2): 1899-1902.
    5.31
12. 
Bodar, N. P.; Himanshu, D. R.; Kandoliya, U. K. and Kakhani, H. (2018).  Effect of interspecific protoplast fusants strain (Trichoderma viride and Trichoderma koningii) on Arachis hypogaea L. for zinc tolerance using physiological and biochemical traits. International Journal of Chemical Studies, 6(2): 1586-1591. (ISSN:  P- 2349–8528 E-ISSN: 2321–4902. NAAS:5.31)
   5.31
13. 
Bodar, N. P.; Kandoliya, U. K.; Rathod, P. J.; Bajaniya, V. K.; Bhadja, N. V. and Golakiya B. A. (2018).  Biochemical changes and fatty acid profiling of consecutively used fried groundnut oil. International Journal of Chemical Studies. 6(2): 231-236. (ISSN:  P- 2349–8528 E-ISSN: 2321–4902.)
   5.31
14. 
Goswami B. R.; Parakhia M. V.; Golakiya B. A. and Kothari C. R. (2018). Morphological and Molecular Identification of Arbuscular Mycorrhizal (AM) Fungi. International Journal of Current Microbiology and Applied Science, 7(01): 2336-2347. doi: https:// doi.org/ 10.20546 /ijcmas. 2018.701.282
5.38
15. 
Bharose, A. A. and Gajera, H. P. (2018). Antifungal Activity and Metabolites Study of Bacillus Strain Against Aflatoxin Producing Aspergillus. Journal of Applied Microbiology and Biochemistry, 18(2): 1-8. DOI: 10.21767/2576-1412.100024
iMedPub
16. 
Gajera, H. P.; Dave, R. A.; Anatala, T. J.; Shihora, M. G. and Golakiya, B. A. (2018).LC-QTOF based Untargeted Metabolites, Bioactive Constituents and Elemental Analysis Associated with Antioxidant Activity in Ficus racemosa L. Indian Journal of Agricultural Biochemistry, 31(1): 39-48. (doi 10.5958/0974-4479.2018.00006.0)
4.69
17. 
Bhadani, R. V.; Gajera, H. P.; Hirpara, D. G.; Kachhadiya, H. J. and Patel, S. V. (2018).Biochemical Characterization and Molecular Variability Associated with Drought Tolerance in Cotton. Indian Journal of Agricultural Biochemistry, 31(1): 9-16 (doi 10.5958/0974-4479.2018.00002.3)
4.69
18. 
Kandoliya, U. K.; Joshi, A. K.; Mori, D S.; Marviya, G. V. and Golakiya, B. A. (2018).Genetic diversity analysis of coconut (Cocos nucifera L.) genotypes and hybrids using molecular marker. Indian Journal of Agricultural Biochemistry, 31(1): 25-32.
    4.1
19. 
Joshi, A. K.; Kandoliya, U. K.; Bodar, N. P. and Golakiya, B. A. (2018). Diversity of coconut (Cocos nucifera L.) Genotypes and hybrids for root total phenol content and different enzymatic activity. Journal of Agricultural Science Research., 2(1): 13-16.
--
20. 
Verma, S.; Tomar, R. S.; Rathod, V.; Thakker, J.; Shubham, Bhagwaat, N.; Raval, S.; Antala, T.; Jogia, Z. and Golakiya, B. A. (2018). Transcriptome Sequencing Analysis of Macrophomina phaseolina Resistant and Susceptible Castor Genotype. Biosciences, Biotechnology Research Asia, 15(1): 195-215.
4.93
21. 
Korat, A. N.; Kavathiya, Y. A.; Lakhani, N. S.; Kandoliya, U. K. and Golakiya, B. A. (2019). Nutritional and antioxidant components of fenugreek (Trigonella foenum-graecum L.) seedlings. Journal of Pharmacognosy and Phytochemistry.,8(1): 443-447.
    5.21
22.
Dhruv, J. J., Patel, N. J., & Parmar, S. (2019). Nutraceutical importance of vegetables and their use for human health: A review. Indian journal of Agricultural Biochemistry, 32(2), 132-142.
4.53
Year 2019-20
1.     
Anuj, S. A.; Gajera, H. P.; Hirpara, D. G. and Golakiya, B. A. (2019). Bacterial membrane destabilization with cationic particles of nano-silver to combat efflux-mediated antibiotic resistance in Gram-negative bacteria. Life Science, 230: 178–187. DOI: https://doi.org/10.1016/j.lfs.2019.05.072
9.23
Elsevier
IF: 3.234
2.     
Hirpara, D. G.; Gajera*, H. P.; Patel, A. K.; Katakpara, Z. A. and Golakiya, B. A. (2019). Molecular insights into development of Trichoderma interfusants for multistress tolerance enhancing antagonism against Sclerotium rolfsii Sacc. Journal of Cell Physiology, 234: 7368–7383. DOI: https://doi.org/10.1002/jcp.27496
10.08
(Wiley)
IF: 4.522
3.     
Anuj, S. A.; Gajera, H. P.; Hirpara, D. G. and Golakiya, B. A. (2019). Interruption in membrane permeability of drug-resistant Staphylococcus aureus with cationic particles of nano‑silver. European Journal of Pharmaceutical Science, 127(1): 208-216. DOI: https://doi.org/10.1016/j.ejps.2018.11.005
9.47
Elsevier
IF: 3.466
4.     
Anuj, S. A.; Gajera, H. P.; Hirpara, D. G. and Golakiya, B. A. (2019). Bactericidal assessment of nano-silver on emerging and re-emerging human pathogens. Journal of Trace Elements in Medicine and Biology, 51(1): 219-225. DOI: https://doi.org/10.1016/j.jtemb.2018.04.028
9.23
Elsevier
IF: 3.225
5.     
Yadav, P. K.; Jasrotia, R. S.; Iquebal, M. A.; Bhatt, S. B.; Arora, V.; Angadi, U. B.; Tomar, R. S.; Jaiswal, S. and Kumar D. (2019). VigSatDB: genome-wide microsatellite DNA marker database of three species of Vigna for germplasm characterization and improvement. Database-The Journal of Biological Databases and Curation, 1–13. doi: 10.1093/database/baz055.
9.98
6.     
Tulsani, N. J.; Hamid, R.; Jacob, F.; Umretiya, N. G.; Nandha, A. K.; Tomar, R. S. and Golakiya B. A. (2019). Transcriptome landscaping for gene mining and SSR marker development in Coriander (Coriandrum sativum L.). Genomics, 112(2): 1545-1553.
8.91
7.     
Jaiswal, S.; Jadhav, P. V.; Jasrotia, R. S.; Kale, P. B.; Kad, S. K.; Moharil, M. P.; Dudhare, M. S.; Kheni, J.; Deshmukh, A. G.; Mane, S. S.; Nandanwar, R. S.; Penna, S.; Manjaya, J. G.; Iquebal, M. A.; Tomar, R. S.; Kawar, P. G.; Rai, A. and Kumar, D. (2019). Transcriptomic signature reveals mechanism of flower bud distortion in witches’-broom disease of soybean (Glycine max). BMC Plant Biology, 19: 26. doi.org/10.1186/s12870-018-1601-1
9.96
8.     
Shelake, P. S.; Dabhi, M. N.; Sabat, M. and Rathod, P. J. (2019). Performance evaluation of developed low‐temperature grinding mill., Journal of Food Process Engineering, 42(8): e13290.
7.96
9.     
Riddhi, P.; Purohit, H. B.; Kandoliya, U. K. and Golakiya, B. A. (2019). Effect of gibberellic acid, potassium nitrate and silicic acid on biochemical constituents and physiological parameter in cowpea (Vigna unguiculata L. Walp) seedling irrigated with saline water. International Journal of Chemical Studies, 7(6): 2162-2172
5.31
10. 
Patel, R. S.; Kadam, D. D.; Kandoliya, U. K. and Golakiya, B. A. (2019). Effect of gibberellic acid, potassium nitrate and silicic acid on enzymes activity in cowpea (Vigna unguiculata L. Walp) irrigated with saline water.Journal of Pharmacognosy and Phytochemistry, 8(5): 1022-1029.
5.21
11. 
Parakhia, M. V.; Tomar, R. S.; Dalal, H.; Kothari, V. V.; Rathod, V. M. and Golakiya, B. A. (2019). Genome Sequence Analysis and Identification of Genes Associated to Pesticide Degradation from Enterobacter cloacae Strain MR2. International Journal of Current Microbiology and Applied Science, 8(1): 2289-2304.
5.38
12. 
Rathod, P. J.; Jithender, B.; Konga, U. and Nickhil, C. (2019). Nutritional and anti-nutritional factors present in oil seeds: An Overview.International Journal of Chemical Studies, 7(6): 1159-1165.
5.31
Year 2020-21
1.     
Anuj, S. A.; Gajera, H. P.; Hirpara, D. G. and Golakiya, B. A. (2020). The impact of bacterial size on their survival in the presence of cationic particles of nano-silver. Journal of Trace Elements in Medicine and Biology, 61: 126517 online
8.90
Elsevier
IF: 3.110
2.     
Hirpara, D. G.; Gajera, H. P.(2020)Green synthesis and antifungal mechanism of silver nanoparticles derived from chitin- induced exometabolites of Trichoderma interfusant. Applied Organometallic Chemistry, 34: e5407
9.26
(Wiley)
IF: 3.14
3.     
Kandoliya, U. K.; Gajera, H. P.; Bodar, N. P. and Golakiya, B. A. 2020. Biochemical and molecular characterization of brinjal varieties and promising genotypes of Saurastra region. Journal of Pharmacognosy and Phytochemistry, 9(4): 1550-1558.
DOI: https://doi.org/10.22271/phyto.2020.v9.i4v.11971
5.21
4.     
Pipaliya, H. R.; Gajera H. P.; Hirpara D. G.; Khunt K. R. and Bhalara R. L. (2020). Effect of Heat Stress on Flower Anatomy of Heat Tolerance and Susceptible Chickpea (Cicer arietinum L.) Genotypes by Scanning Electron Microscopy. International Journal of Bioresource and Stress Management, 11(1): 082-088.
DOI: https://DOI.ORG/10.23910/IJBSM/2020.11.1.2071a
4.65
5.     
Parakhia, M. V. and Golakia, B. A. (2021) Microbiome of Groundnut (Arachis hypogaea L.) Rhizosphere Infected with Macrophomina pheseolina Root Rot. International Journal of Current Microbiology and Applied Sciences, 10(02): 141-149.
5.38
Year 2021-22
1.     
Darshna G. Hirpara, Harsukh P. Gajera, Disha D. Savaliya, and Rushita V. Bhadani (2021). Characterization and bioefficacy of green nanosilver particles derived from fungicide-tolerant Tricho-fusant for efficient biocontrol of stem rot (Sclerotium rolfsii Sacc.) in groundnut (Arachis hypogaea L.). Journal of Microbiology 59 (11): 1031–1043
DOI: https://doi.org/10.1007/s12275-021-1344-9
8.90
(Springer)
IF: 3.7
2.     
Rushita V. Bhadani, H. P. Gajera, Darshna G. Hirpara, Harshita J. Kachhadiya, R. A. Dave (2021) Metabolomics of extracellular compounds and parasitic enzymes of Beauveria bassiana associated with biological control of whiteflies (Bemisia tabaci). Pesticide Biochemistry and Physiology  176: 104877
DOI: https://doi.org/10.1016/j.pestbp.2021.104877
10.97
(Elsevier)
IF: 4.7
3.     
Sandhya K. Trivedi, H. P. Gajera, D. D. Savaliya and R. V. Bhadani (2021). Biochemical and physiological changes influenced by saline water stress in chickpea (Cicer arietinum L.). Indian Journal of Agricultural Biochemistry,34 (1): 33-38.
doi 10.5958/0974-4479.2021.00004.6
4.38
4.     
Hiral Desai, Rasmieh Hamid, Zahra Ghorbanzadeh, Nishant Bhut, Shital M Padhiyar, Jasminkumar Kheni, and Rukam S. Tomar (2021). Genic Microsatellite Marker Characterization and Development in Little millet (Panicum sumatrense) using transcriptome sequencing. Scientific Reports, 11, 20620. https://doi.org/10.1038/s41598-021-00100-4
10.38
5.     
Nidhi Radadiya, Naman Mangukia, Virali Antala, Hiral Desai, Hemangini Chaudhari, T. L. Dholaria, Rukam Singh Tomar, B. A. Golakiya and Mahesh Mahatma (2021). Transcriptome analysis of sesame-Macrophomina phaseolina interactions revealing the distinct genetic components for early defense responses. Physiology and Molecular Biology of Plants,27, 1675–1693.https://doi.org/10.1007/s12298-021-01039-6.
8.39
6.     
Rakesh Nogiya, MK Mahatma, Avinash Gowda H, SS Raval, V Rathod, HP Gajera, R. S. Tomar & Narendra Kumar (2021). Changes in expression of polyamines and ethylene biosynthesis genes in groundnut (Arachis hypogaea L.) genotypes during Sclerotium rolfsii infection. Indian Journal of Experimental Biology, 58, 476-483.
6.78
7.     
Balaji Rathod, Riddhi Rajyaguru, Shashikant Sharma and Rukam Singh Tomar (2021). Oil content and fatty acid profiling of soybean (Glycine max L. Merrill) of Indian cultivar. The Pharma Innovation Journal; 10(9): 24-29.
5.23
8.     
Sharma, S. K., Rajyaguru, R., Gajera, H. P., Tomar, R. S., Kheni, J., Bhalani, H. and Golakiya, B. A. (2021). Optimization of in vitro regeneration protocol for tomato (Solanum lycopersicon Mill.) Cv. Junagadh Tomato-3. Journal of Cell and Tissue Research, 21(2): 7081-7090.
4.04
9.     
Vasava, D. K., Kheni, J. K., Bhalani, H. N., Padhiyar, S. M., Rajyaguru, R., Desai, H. and Tomar, R. S. (2021). Mining and development of EST-SSR markers from public expressed sequence tags databases for the study of spine gourd (momordica dioica) male and female plant. Journal of Cell and Tissue Research, 21(1): 7057-7062.
4.04
10. 
Tatmiya Ritisha N., Ambalam Padma and Tomar Rukam S. (2021). Metabolomics of groundnut (Arachis hypogaea L.) genotypes during groundnut- Sclerotium rolfsii interaction at different stages of infection. Research Journal of Biotechnology, 16 (4), 101-111.
4.0
11. 
Saxena Akansha, Padhiyar S.M., Kheni J. and Tomar Rukam S. (2021). Character associations, path analysis and molecular characterization in Cowpea (Vigna unguiculata L.). Research Journal of Biotechnology, 16 (2), 141-148.
4.0
12. 
Lenka B, Kulkarni G U, Mehta D R, Tomar R S, Mungra K D and Patel J B (2021). Combining ability studies for grain and dry fodder yield per plant in pearl millet [Pennisetum glaucum (L.) R. Br.] Using line x tester analysis over environments. The Pharma Innovation Journal; 10(12):2483-2491.
5.23
13. 
Bhukya Jithender, DM Vyas, C Nickhil, PJ Rathod (2021). Development of juice extraction process for pomegranate (Punica granatum): Evaluation and physicochemical aspects. Indian Journal of Agricultural Sciences. 91 (6):936–938
6.0
14. 
Neha J. Hirpara, M.N. Dabhi and P.J. Rathod. (2021). Development of Potato Starch Based Biodegradable Packaging Film. Biological Forum – An International Journal 13(1):529-541
5.11
15. 
T.H Barad, Chandegara VK, Rathod P.J and Mori M.R.(2021).Quality evaluation of a jaggery prepared from developed three pan jaggery making furnace. International Journal of Chemical Studies.  9(1):907-913
--
16. 
MV Solanki, PJ Rathod and MK Mahatma. (2021). Trends of antinutritional compounds in groundnut pod at development stages during drought conditions. The Pharma Innovation Journal. SP-10(10):1107-1111
5.23
17. 
Charan Singh, Dhamsaniya N K, Rathod Pankajkuamr jemalbhai (2022) Effect of ultraviolet-c radiation processing on physical and microbial properties of horticulture produce. The Pharma Innovation Journal.11(6):1798-1804
5.23
18. 
Sirwani, P. M., Dabhi, M. N., & Rathod, P. J. (2022). Effect of low temperature grinding on phytochemicals profile of fenugreek seed powder: Effect of grinding methods on the quality of fenugreek seed powder. Journal of Spices and Aromatic Crops, 31:(2) 177–186. https://doi.org/10.25081/josac.2022.v31.i2.7958
4.85
Year 2022-23
1.     
Harshita J. Kachhadiya, H. P. Gajera, D. R. Mehta, Darshna G. Hirpara, Rushita V. Bhadani, R. A. Dave (2022). Comparative Appraisal of leaf proteomic and mass spectrometry analyses during fusarium wilt infection in resistance and susceptible genotypes of castor (Ricinus communis L.). The Protein Journal 41: 638–658.
DOI: https://doi.org/10.1007/s10930-022-10083-4
10.00
(Springer)
IF: 4.000
2.     
Rushita V. Bhadani, H. P. Gajera, Darshna G. Hirpara, Harshita  J.  Kachhadiya (2022). Characterization and bio‑eicacy of entomopathogenic Beauveria associated with cuticle‑degrading enzymes to restrain sucking pest Bemisia tabaci.Parasitology Research,121: 2019–2031
DOI: https://doi.org/10.1007/s00436-022-07557-w
8.38
(Springer)
IF: 2.38
3.     
Rushita V. Bhadani, H. P. Gajera, Darshna G. Hirpara, D. D. Savaliya, Samir A. Anuj (2022). Biosynthesis and characterization of extracellular metabolites-based nanoparticles to control the whitely. Archives of Microbiology, 204:311
DOI: https://doi.org/10.1007/s00203-022-02917-7
8.67
(Springer)
IF: 2.67
4.     
H. P. Gajera, Darshna G. Hirpara, Rushita V. Bhadani, B. A. Golakiya (2022). Green synthesis and characterization of nanosilver derived from extracellular metabolites of potent Bacillus subtilis for antifungal and eco-friendly action against phytopathogen. Biometals 35: 479–497.
DOI: https://doi.org/10.1007/s10534-022-00382-9
9.38
(Springer)
IF: 3.38
5.     
M. N. Dabhi*, P. R. Davara, H. P. Gajera, Nirav Joshi, and Parth Saparia (2022). Bioactive Compounds of Turmeric Powder Affected by Grinding Method and Feed Temperature. International Journal of Agriculture, Environment and Biotechnology, 15 (Special Issue): 337-345. DOI: 10.30954/0974-1712.03.2022.8
4.54
6.     
Harsh B. Purohit, H. P. Gajera, D. D. Savaliya and Darshna G. Hirpara (2022). Physiological and Biochemical changes during in vitro germination under salinity stress in groundnut (Arachis hypogaea L.). The Pharma Innovation Journal, 11(7): 55-63.
5.23
7.     
Nimisha V Hirani, H. P. Gajera, Darshna G. Hirpara and R. L. Bhalara (2022). Microbiome characterization of PGPR isolated from Fusarium wilt infected cumin Rhizosphere. The Pharma Innovation Journal, 11(8): 1115-1126.
5.23
8.     
Kinjal M. Hirapara, H. P. Gajera, D. D. Savaliya and D. G. Hirpara (2022). Biochemical and physiological changes influenced by drought stress in chickpea (Cicer arietinum L.). Indian Journal of Agricultural Biochemistry, 35 (1), 79-86. doi 10.5958/0974-4479.2022.00012.0
4.38
9.     
Khushbu A. Thummar, Sandhya K. Trivedi, H. P. Gajera and D. D. Savaliya (2022). Antioxidant defence system induced by seed priming with nanoparticles to restrain Fusarium wilt in cumin (Cuminum cyminum L.). Indian Journal of Agricultural Biochemistry, 35 (1): 27-34. doi 10.5958/0974-4479.2022.00004.1
4.38
10. 
C. Tara Satyavathi, Rukam S. Tomar, Supriya Ambawat, Jasminkumar Kheni, Shital M. Padhiyar, Hiralben Desai, S.B. Bhatt, M. S. Shitap, Ramesh Chand Meena, S. Mukesh Sankar, S.P. Singh and Vikas Khandelwal (2022). Stage Specific Comparative Transcriptomic Analysis to Reveal Gene Networks Regulating Iron and Zinc Content in Pearl Millet [Pennisetum glaucum (L.) R. Br.]. Scientific Reports, 12:276. https://doi.org/10.1038/s41598-021-04388-0
10.38
11. 
Ashish Vala, Nasreen Bano, Yogita Deshmukh, Rukam S. Tomar, CG Joshi, N Subhash (2022). Transcriptome analysis identifies novel gene (s) and pathways for salt stress responses in Dandi cultivar. Cereal Research Communications, https://doi.org/10.1007/s42976-022-00319-5.
7.20
12. 
Likhindra Reang, Shraddha Bhatt, Rukam S. Tomar, Kavita Joshi, Shital Padhiyar, U. M. Vyas & Jasmin Kumar Kheni(2022). Plant growth promoting characteristics of halophilicand halotolerant bacteria isolated from coastal regions of Saurashtra Gujarat. Scientific Reports, 12:4699.  https://doi.org/10.1038/s41598-022-08151-x
10.38
13. 
Jalaja S. Menon, Berin Pathrose, A. C. Asna, Rukam S. Tomar and B. Dineshkumar (2022). Morphological, biochemical, molecular marker, GC-MS analysis of garlic (Allium sativum L.) landraces in the rain shadow high hills of Kerala. Pharmacognosy Magazine, 18(77):121-127. DOI:10.4103/pm.pm_435_21  
7.10
14. 
Rukam S. Tomar, Ramesh K. Solanki, M. A. Iquabal, S. M. Padhiyar, and J. K. Kheni (2022). Deciphering Chloroplast Genome of Indian Cultivar Gujarat Cumin 4: First Report. Annals of Arid Zone, 61(1): 71-74.
4.70
15. 
Chauhan K. P., Kulkarni G. U., Sharma L. K., Patel J. B., Babariya C. A. and Tomar R. S. (2022). Impact of apical pinching and fruit picking on seed quality parameters of okra (Abelmoschus esculentus (L.) Moench). The Pharma Innovation Journal; 11(11): 490-492.
5.23
16. 
Hemangini A Chaudhari, Antala Virali, Nidhi Radadiya, Mahesh Kumar Mahatma and Rukam S. Tomar (2022). Selection of suitable reference gene for gene expression studies during groundnut seed germination. Research Journal of Biotechnology, 17(2), 64-71.
4.00
17. 
Chander Kanta Kumawat, G.U. Kulkarni , R. S. Tomar , B.A. Monapara, A.G. Pansuriya and L.K. Sharma (2022). Per Se Performance of Brinjal (Solanum melongena L.) Hybrids for Fruit Yield and its component Traits under Normal and Organic Environments. Biological Forum – An International Journal, 14(4): 441-448.
5.11
18. 
Khaniya J, GU Kulkarni, BA Monpara, DR Mehta, LK Sharma and R. S. Tomar (2022). Narrow-sense heritability and genetic advance for seed yield and yield attributing traits in medium duration pigeonpea [Cajanus cajan (L.) Mill sp.]. The Pharma Innovation Journal, 11(9): 413-417.
5.23
19. 
Dhawale R N, Padhiyar Shital M, Kheni Jasminkumar and Tomar R. S. (2022). Metabolomic profiling of drought-tolerant little millet (Panicum sumatrense L.) genotype in response to drought stress. The Pharma Innovation Journal, 11(4): 1754-1762.
5.23
20. 
Tomar Rukam S, RK Solanki, SM Padhiyar, JV Kheni and RK Kakani (2022). Flow cytometric genome size estimation of major seed spice grown in India. The Pharma Innovation Journal, 11(6): 507-510.
5.23
21. 
Pappy Ready, Pritesh Sabara, Shital M. Padhiyar, Kulkarni, G. U., J. V. Kheni and Rukam S. Tomar (2022). Genetic Diversity of Groundnut (Arachis hypogaea L.) revealed by RAPD and ISSR Markers. Annals of Arid Zone, 60(3&4): 109-115.
4.70
22. 
Shital M Padhiyar, Jasminkumar Kheni, Hiral V Desai, Rukam S. Tomar and H. P. Gajera (2022). Metabolomic characterization of barnyard millet (Echinochloa frumentacea L.) involved in different stages of spike development. The Pharma Innovation Journal, 11(6): 604-611.
5.23
23. 
V.M. Sejani, N.K. Dhamsaniya, P.J. Rathod (2022) Preparation of Peanut Flour based Thabdi Peda. Journal of Dairying, Foods & Home Sciences. 42(2): 237-241
5.75
24. 
V.M. Sejani N.K. Dhamsaniya and P.J. Rathod (2022) Effect of Peanut Flour on Proximate Composition ofThabdi Peda.Biological forum-An International Journal.14(3):1052-1057 ISSN No. (Print): 0975-1130
4.54
25. 
Bhukya Jithender, D. M. Vyas, Nickhil C, P. J. Rathod (2022). Optization of Developed Continuous Type Pomegranate Juice Ex- tractor AGRICULTURAL MECHANIZATION IN ASIA, AFRICA AND LATIN AMERICA(53)65-72
6.14
26. 
Shingala Abhishaben M, Dabhi MN, Rathod PJ, Dharsenda T L (2022) .Effect of ozone gas exposure time and ozone cycle on starch content of wheat (Triticum aestivum) during bulk storage. The Pharma Innovation Journal .11(10):1621-1626
5.23
27. 
VB Gore, PJ Rathod, AG Vala, D Kumar (2022) Analysis of protein profiling through SDS-PAGE of spreading types varieties of groundnut grown in India. The Pharma Innovation Journal.1(9):2811-2817
5.23
28. 
Shingala, A.M, Dabhi, M.N., Rathod, P.J, Rathod R.R (2022) Influence of Ozone Treatment on Carbohydrate Content of Wheat (Triticum aestivum) during Bulk Storage            Int. J. Ag. Env. Biotech. 15 (1)401-406..
5.23
29. 
Charan Singh, Dhamsaniya N K, Rathod Pankajkumar Jemalbhai (2022)Effect of Ultraviolet-C Irradiation on Storability of Sapota.Biological Forum – An International Journal  14:(3)194-198
4.54
30. 
V.M. Sejani, N.K. Dhamsaniya, P.J. Rathod (2022) Preparation of Peanut Flour based Thabdi Peda. Journal of Dairying, Foods & Home Sciences. 42(2): 237-241
5.75
Year 2023-24
1.     
Khyati R. Savani; H. P. Gajera; Darshna G. Hirpara; Disha D. Savaliya; U. K. Kandoliya (2023). Salicylic acid-functionalised chitosan nanoparticles restore impaired sucrose metabolism in the developing anther of cotton (Gossypium hirsutum) under heat stress. Functional Plant Biology, on line
DOI: https://doi.org/10.1071/FP22309
8.81
(CSIRO Publishing)
IF: 3.000
2.     
H. P. Gajera, Darshna G. Hirpara, Disha D. Savaliya, M. V. Parakhia (2023). Biochemical and molecular depictions to develop ech42 gene‑ specific SCAR markers for recognition of chitinolytic Trichoderma inhibiting Macrophomina phaseolina (Maubl.) Ashby. Archives of Microbiology, 205 (6): 242 on line
DOI: https://doi.org/10.1007/s00203-023-03582-0
8.67
(Springer)
IF: 2.667
3.     
Darshna G. Hirpara and Harsukh P. Gajera (2023). Intracellular metabolomics and microRNAomics unveil new insight into the regulatory network for potential biocontrol mechanism of stress‐tolerant Tricho‐fusants interacting with phytopathogen Sclerotium rolfsii Sacc. Journal of Cellular Physiology 238 (6): 1288-1307
DOI: https://doi.org/10.1002/jcp.31009
12.51
(Wiley)
IF: 6.513
4.     
Darshna G. Hirpara, H. P. Gajera, Disha D. Savaliya, M. V. Parakhia (2023). Exploring conserved and novel MicroRNA-like small RNAs from stress tolerant Trichoderma fusants and parental strains during interaction with fungal phytopathogen Sclerotium rolfsii Sacc. Pesticide Biochemistry and Physiology 191: 105368
DOI: https://doi.org/10.1016/j.pestbp.2023.105368
10.97
(Elsevier)
IF: 4.966
5.     
Smrutirekha Sahu, UK Kandoliya and HP Gajera (2023). Evaluating the impact of iron oxide nanoparticles on nutritional parameters and yield attributes of groundnut grown in calcareous soils. The Pharma Innovation Journal, 12(9): 2246-2250.
5.23
6.     
Tajender Kumar, Timbadiya P. N., Kandoliya U. K., Parakhia M. V. and  Gajera H. P. (2023). Assessing the Nutritional and Antinutritional Components of Promising Kabuli Chickpea (Cicer arietinum L.) Genotypes, International Journal of Economic Plants, 10(2): 122-126.
Doi: HTTPS://DOI.ORG/10.23910/2/2023.0517
4.37
7.     
Ashish Chovatiya, Riddhi Rajyaguru, Rukam Singh Tomar and Preetam Joshi (2023). Revolutionizing Agriculture: Harnessing CRISPR/Cas9 for Crop Enhancement. Indian Journal of Microbiology, https://doi.org/10.1007/s12088-023-01154-w
9.00
8.     
VishaRathod, Khyati Rathod, Rukam S. Tomar, Ritisha Tatamiya, Rasmieh Hamid, Feba Jacob and Nasreen Shakil Munshi (2023). Metabolic profiles of peanut (Arachis hypogaea L.) in response to Puccinia arachidis fungus infection. BMC Genomics 24, 630. https://doi.org/10.1186/s12864-023-09725-3
10.55
9.     
Shital M. Padhiyar, Jasminkumar Kheni, Hiral Desai and Rukam S. Tomar (2023). Comparative transcriptome profiling of high and low grain-iron containing Indian barnyard millet (Echinochloa frumentacea L.) genotypes during different stages of grain development. Haliyon
10.00
10. 
Riddhi Rajyaguru and Rukam S. Tomar (2023). Induction of new allelic variant of AhFAD2B gene in peanut cultivar, GG20 through CRISPR/Cas9-mediated mutagenesis. Journal of Plant Biochemistry and Biotechnology
7.52
11. 
Ramesh Narayanrao Dhawale, Rukam Singh Tomar, Shital Padhiyar, Jasminkumar Kheni, Gulwe Ashish and Sunil Tulahiram Hajare (2023). De Novo transcriptome Sequencing and Metabolic profiling of Drought tolerance associated genes in little Millet (Panicum sumatrense L.). Functional and Integrative Genomics, 23:303. https://doi.org/10.1007/s10142-023-01221-x
9.67
12. 
Hemangini A. Chaudhari, Mahesh Kumar Mahatma, Virali Antala, Nidhi Radadiya, Piyush Ukani, Rukam Singh Tomar, Lokesh Kumar Thawait, Sushmita Singh, K. Gangadhara, Amar Sakure and Akrash Parihar (2023). Ethrel-induced release of fresh seed dormancy causes remodeling of amylase activity, proteomics, phytohormone, and fatty acid profile of groundnut (Arachis hypogaea L.). Physiology and Molecular Biology of Plants, https://doi.org/10.1007/s12298-023-01332-6
9.50
13. 
Srutiben A Gundaraniya, Padma Ambalam, Roli Budhwar, Shital M Padhiyar and Rukam S. Tomar* (2023). Transcriptome analysis provides insights into the stress response in cultivated peanut (Arachis hypogaea L) subjected to drought stress. Molecular Biology Report, https://doi.org/10.1007/s11033-023-08563-6  
8.74
14. 
Nikita S. Patel, Jagdish. B. Patel and Rukam. S. Tomar (2023). Identification of heat tolerant bread wheat (Triticum aestivum L.) genotypes through heat susceptibility index (HSI) and SSR markers. Cereal Research Communications, https://doi.org/10.1007/s42976-023-00426-x
7.77
15. 
Chintan Kapadia, Rahul Datta, Saiyed Mufti Mahammad, Rukam Singh Tomar, Jasmin Kumar Kheni, and Sezai Ercisli(2023). Genome-wide identification, quantification, and validation of differentially expressed miRNAs in Eggplant (Solanum melongena L.) based on sequencing of small RNA sequences in response to Ralstonia solanacearum infection. ACS Omega, DOI: 10.1021/acsomega.2c07097
10.13
16. 
Pappy Ready, Pritesh Sabara, Shital M. Padhiyar, Kulkarni, G. U. and Rukam S. Tomar (2023). Correlation and path analysis in groundnut (Arachis hypogaea L.) genotypes through agro-morphological study. Annals of arid zone, 62(3): 227-234.
4.70
17. 
Ashish G. Vala, Rukam Singh Tomar, Pankaj J. Rathod, and Rajivkumar (2023). Speed Breeding: Accelerating Crop Improvement through Controlled Environments, Genetics, and High-Throughput Phenotyping. International Advanced Research Journal in Science, Engineering and Technology, 10(5), 746-749.
4.00
18. 
Ashish Vala, Nasreen Bano, Yogita Deshmukh, Rukam S. Tomar, CG Joshi, N Subhash (2023). Genomics Approaches for Enhancing Abiotic Stress Tolerance in Groundnut: A Pathway to Crop Improvement. International Journal of Science and Research Archive,
4.00
19. 
Shital M. Padhiyar, H.P. Supreeth, R.K. Solanki, K.D. Mungra and Rukam S. Tomar (2023). Assessment of Molecular Diversity Among Pearl Millet [Pennisetum glaucum (L.) R. Br.] Maintainer (B) and Restorer Lines. Annals of Arid Zone 62(1): 55-63
4.70
20. 
Meniya V.H., Shital M. Padhiyar, Hiral Desai, Jasminkumar Kheni and Rukam S. Tomar (2023). Development and Validation of Microsatellite Markers for Barnyard Millet Obtained by Partial Genome Assembly. Annals of Arid Zone 62(1): 83-89
4.70
21. 
Vaibhav Vyas, Paresh Davara, Ashish Joshi, Mukesh Dabhi, Pankajkumar Rathod and Parthkumar Sapariya (2023). Physical and sensory properties of peanut sauce prepared through fermentation process.The Pharma Innovation Journal12(5): 2620-2625
5.23
22. 
V. B. Gore, P. J. Rathod, A. G. Vala, Gulla Bhavitha, D. Kumar (2023). Fatty acid profiling through GC-MS in oil extracted from thirty varieties of groundnut grown in Gujarat, India. Emergent Life Sciences Research 9(1):149-158
5.75
23. 
NU Joshi, MN Dabhi and PJ Rathod (2023). A review on factors affecting Dehusking operation of different agricultural products. The Pharma Innovation Journal SP-12(11): 478-482
5.23
24. 
Chandani Popalia, VK Chandegara, PJ Rathod. (2023). Valorization of sweet orange peel by fluidized bed drying and cryogenic grinding: Colour characteristics evaluation. Pharma Innovation 12(5):1149-1154.
5.23
25. 
Sejani V.M., Dhamsaniya N.K., Rathod P.J. (2023).Preparation of peanut flour based Thabdi peda. Asian Journal of Dairy and Food Research
 42(2):237-241
5.5
26.
Amiben, Lakhani and Benharlal, P. S and Kandoliya, U. K. (2024) Partial Chemical Characterization of Drought-Related Metabolites in Maize Under Drought Stress Conditions. International Journal of Environment and Climate Change, 14 (1). pp. 338-348. ISSN 2581-8627
5.13
27.
Hinal Patoliya, UK Kandoliya, HP Gajera, PK Ukani. (2024) The effect of Gibberellic acid, Abscisic acid and salicylic acid on Metabolome profiling in wheat (Triticum aestivum L.) irrigated with saline water. Int J Adv Biochem Res. 8(1S):373-380.
5.29
28.
N. C. Chovatiya, H. P. Gajera*, Disha D. Savaliya, Darshna G. Hirpara, Khyati R. Savani (2023). Antioxidant enzymes influenced by nanoparticle treatments during fusarium wilt infection in castor (Ricinus communis L.). Indian Journal of Agricultural Biochemistry, 36(2): 145-152.DOI: 10.5958/0974-4479.2023.00023.0
5.12
29.
Kalpna K. Patel, U. K. KandoliyaH. P. Gajera,  Darshna G. Hirpara,  Disha D. Savaliya (2023). Assessing the variability based on nutritional, antinutritional parameters and ISSR markers among the promising genotypes of black gram (Vigna mungo L.). Indian Journal of Agricultural Biochemistry, 36(2): 130-135.
5.12
30.
Vavdiya, P. A., Naghera, Y. V., Mungra, K. S. and Bhut, N. M. (2023). Genetic variability studies and path coefficient analysis in parents and F1 families of sesame (Sesamum indicum L.). The Pharma Innovation Journal 12(12): 1590-1593.
5.23
31.
Mungra, K. S., Vavdiya, P. A., Naghera, Y.V., Chauhan, D. A. and Prajapati, M. R. (2023). Genetic analysis for yield and other important characters related to yield in cowpea (Vigna unguiculata L.) Walp.). Biological Forum- An International Journal 15(11): 533-536. 
5.11
32.
Solanki, M. V., Mahatma, M. K., Varma, A., Thawait, L. K., Singh, S., Jangir, C. K., Ashish Vala &Kandoliya, U. K. (2024). Water deficit stress enhances the bioactive compounds of groundnut (Arachis hypogaea L.) kernels at the expense of primary metabolites. Food Bioscience, 58, 103670.
11.20
33.
Khaniya, J.; Talpada, M. M.; Sapovadiya, M. H.; Kulkarni, G. U. and Mehta, D. R. (2023). Spectrum of Genetic Variability, Correlation and Path Analysis for Yield and Yield Contributing Traits in Bunch Groundnut (Arachis hypogaea L.). The Pharma Innovations, 12(12): 2850-2854. 
5.23
34.
S. R. Parmar, J. J. Dhruv and J. D. Dobariya (2023). Effect of seed priming on morphological characters with melatonin and nematicide in tomato (Solanum Lycopersicon L.). The Pharma Innovation Journal, 12(12):2155-2159. 
5.23
35.
 S. R. Parmar, J. J. Dhruv and Tulika singh (2023). Screening and evaluation of tomato (Solanum Lycopersicon L.) cultivars against root-knot nematode (spp. Meloidogyne incognita and Meloidogyne javanica). The Pharma Innovation Journal, 12(12):2921-2925. 
5.23
Year 2024-25
1.
H. P. Gajera*, Darshna G. Hirpara, Rushita V. Bhadani, U. K. Kandoliya, M.G. Valu, (2024). Integrating genetic assortment and molecular insights for climate-resilient breeding to unravel drought tolerance in cotton. Journal of Biotechnology, 394: 92-102. DOI: https://doi.org/10.1016/j.jbiotec.2024.08.013
NAAS: 10.1
IF: 4.10
 (Elsevier)
2.
Kinjal M. Hirapara, H. P. Gajera*, Darshna G. Hirpara, D. D. Savaliya (2024). Deciphering metabolomic responses and signaling pathways for augmented osmotic stress tolerance under nanosilicon influence in chickpea (Cicer arietinum L.). South African Journal of Botany, 171: 768-779. DOI: https://doi.org/10.1016/j.sajb.2024.06.046
NAAS: 8.7
IF: 3.10
 (Elsevier)
3.
M. N. Ashwini, H. P. Gajera*, Darshna G. Hirpara, Disha D. Savaliya, U. K. Kandoliya  (2024). Comparative impact of seed priming with zinc oxide nanoparticles and zinc sulphate on biocompatibility, zinc uptake, germination, seedling vitality, and antioxidant modulation in groundnut. Journal of Nanoparticle Research 26, 235.
DOI: https://doi.org/10.1007/s11051-024-06141-w
8.1
(Springer)
IF: 2.10
4.
Harsukh P. Gajera*, Darshna G. Hirpara, Shila N. Gevariya, Disha D. Savaliya, & Jigar S. Parasana (2024). Exploring the antioxidant and antidiabetic potentials of Syzygium cumini L. landraces: phytochemicals, bioactive constituents and pathway enrichment analysis. International Journal of Food Science & Technology, 59(8): 5818–5828.
DOI: 10.1111/ijfs.17337
NAAS: 8.6
IF: 3.30
 (Wiley)
5.
P. M. Muchhadiya, S. B. Bhatt, V. R. Umaretiya, M. V. Parakhia, U. K. Kandoliya, H. P. Gajera, S. M. Padhiyar, K. B. Joshi. (2024). Genetic characterization and diversity of nitrogen fixing Rhizobium spp. isolated from root nodules of legumes. International Journal of Advanced Biochemistry Research 8(8S):301-311.
DOI: 10.33545/26174693.2024.v8.i8Se.1794
5.29
6.
K. M. Hirapara, S. B. Bhatt, V. R. Umaretiya, M. V. Parakhia, U. K. Kandoliya, H. P. Gajera, U. M. Vyas, S. M. Padhiyar, K. B. Joshi (2024). Exploring agricultural soils of the Saurashtra region for entomopathogenic bacteria and fungi: Isolation, characterization and phylogenetic analysis. International Journal of Advanced Biochemistry Research, 8(8S):233-242. DOI:10.33545/26174693.2024.v8.i8Sd.1775
5.29
7.
V. R. Chavda, S. B. Bhatt, M. V. Parakhia, U. K. Kandoliya, H. P. Gajera, V. R. Umaretiya, S. M. Padhiyar, K. B. Joshi (2024). Qualitative and quantitative estimation of enzymes produced by endophytic bacteria of medicinal plants. International Journal of Advanced Biochemistry Research, 8(8): 164-170.
5.29
8.
Hinal Patoliya, U. K. Kandoliya, H. P. Gajera and P. K. Ukani (2024).The effect of Gibberellic acid, Abscisic acid and salicylic acid on Metabolome profiling in wheat (Triticum aestivum L.) irrigated with saline water. International Journal of Advanced Biochemistry Research, SP-8(1): 373 – 380.
DOI: https://doi.org/10.33545/26174693.2024.v8.i1Sf.339
5.29
9.
M. V. Solanki, M. K. Mahatma, Aman Varma, L. K. Thawait, Sushmita Singh, C. K. Jangir, M. D. Meena , R. S. Tomar, P. J. Rathod, Ashish Vala, U. K. Kandoliya (2024). Water deficit stress enhances the bioactive compounds of groundnut (Arachis hypogaea L.) kernel at the expense of primary metabolites. Food Bioscience 58, (1-7) 103670.
11.20
10.
Meera K Joshi, Gopal V Marviya, Feba Jacob, Umesh K Kandoliya, Priyanka M Pandya, Ashish G Vala (2024). System-wide analysis of groundnut's salinity resilience: Integrating plant-cell interactions with environmental stress dynamics through cutting-edge transcriptomics. Journal of Biotechnology. 394 (34-47).
10.10
11.
N. C. Chovatiya ID, U.K. Kandoliya, M. J. Parmar, Hilay Dudhat (2024). Physiological and biochemical changes during in vitro germination under salinity stress in green gram (Vigna radiata (L.) R. Wilczek). International Journal of Advanced Biochemistry Research 8(7): 355-361.
-
12.
K. L. Taviyad, P. N. Timbadiya, U. K. Kandoliya, A. G. Vala, and M.V. Parakhia (2024). Exploring Genetic Diversity in Promising Genotypes of Mung Bean (Vigna radiata (L.) Wilczek) through RAPD Markers. Frontiers in Crop Improvement 12(1): 56-60.
-
13.
Antiya, P. M., Naghera, Y. V., Vavdiya, P. A. and Mungra, K. S. (2024). Variability studies in fennel (Foeniculum vulgare Mill.). International Journal of Theorotical and Applied Science 16(2): 43-47.
3.74
14.
M V Parakhia, Neha Chovatiya, Zarna Vora, Hiren Bhalani and U K Kandoliya (2025) Assessment of genetic diversity of sesame accessions using sequence-related amplified polymorphism (SRAP) markers, International Journal of Agriculture and Plant Science, 7(1):41-48.
4.85
15.
Manoj Parakhia, Zarna Vora, Neha Chovatiya, Hiren Bhalani and Shradha B Bhatt (2025) Evaluation of SRAP marker efficiency to identifying genetic diversity among genotypes of greengram (Vigna radiata) (L.), International Journal of Agriculture and Plant Science, 7(1):63-68.
4.85
16.
Neha D Chovatiya, Manoj V Parakhia, Shradha B Bhatt and Manish H Sapovadiya (2025) Nutritional composition of millets and its genetic diversity reveal through SRAP markers, International Journal of Agriculture and Plant Science, 7(1):23-28.
4.85
17.
Reang L., Bhatt S., Tomar R. S., Joshi K., Padhiyar S., Bhalani H., Kheni J., Vyas U.M., Parakhia M. V. (2024). Extremozymes and compatible solute production potential of halophilic and halotolerant bacteria isolated from crop rhizospheric soils of Southwest Saurashtra Gujarat. Scientific Reports 14: 15704
9.8
18.
Padhiyar S., Kheni J., Bhatt S., Desai. H., Tomar R. S. (2024).Transcriptome profiling of barnyard millet (Echinochloa frumentacea L.) during grain development to reveal the genomic insights into iron Accumulation. Heliyon. 10(10). e30925,  
9.4
19.
Ishwarya Lakshmi, V. G.; Basavaraj, P. S.; Muralidhara, B.; Hima Bindu, P.; Ajitha, V.; Manoj, C. A.; Jay, K.; Anantha, M. S. and Gireesh, S. (2024). Elucidating the Genetic Diversity and Population Structure of African Rice (O. glaberimma) Germplasm using Microsatellite Marker.South African Journal of Botany, 117(2025): 411-420.
DOI: https://doi.org/10.1016/j.sajb.2024.12.018
8.7
(Elsevier)
20.
Sodhaparmar, H. R., Patel, N. J., & Bedse, T. J. (2024). Biochemical characterization of wheat and their anti-nutritional composition. International Journal of Advanced Biochemistry, S P-8 (1): 87- 93
5.29
21.
Sodhaparmar, H. R., Shukla, Y. M., Dhruve, J. J., Patel, N. A., &Bedse, T. J. (2024). Identification of simple sequence repeats (SSRS) for TLCV resistacne in tomato (Solanum lycopersicum L.). International Journal of Advanced Biochemistry, S P- 8(1): 173 -1 84
5.29
Papers Presented in Seminar/Symposia
Sr. No.
Details of Publication
1.
Gajera, H. P.; Hirpara, D. G.; Patel, D. S. and Golakiya, B. A. (2016). Green synthesis and characterization of nanoparticles derived from potent Bacillus antagonist for biocontrol activity against Fusarium wilt in cumin. International Conference on "Nutraceuticals and Functional Foods- The Challenges and Opportunities”, Anand, AAU, Dec. 6-8, Pp. 30
2.
Gajera, H. P.; Hirpara, D. G.; Gevariya, S. N. and Golakiya, B. A. (2016). Nutraceutical, antioxidant and antidiabetic potentials associated with fruit size of indegeouns black jamun (Syzygium Cumini L.) landraces. International Conference on "Nutraceuticals and Functional Foods- The Challenges and Opportunities”, Anand, AAU, Dec. 6-8, Pp. 49.
3.
Katakpara, Z. A.; Savaliya, D. D.; Gajera, H. P. and Patel S. V. (2016). Characterization of eugenol for therapeutic potential derived from Tulsi (Ocimum sanctum L.) leaves. International Conference on "Nutraceuticals and Functional Foods- The Challenges and Opportunities”, Anand, AAU, Dec. 6-8, Pp. 102.
4.
Hirpara, D. G.; Gajera, H. P.; Hirpara, J. G. and Golakiya, B. A. (2016). In vitro antifungal activities against Sclerotium rolfsii and molecular diversity in Trichoderma strains using SRAP markers. International Conference on "Nutraceuticals and Functional Foods- The Challenges and Opportunities”, Anand, AAU, Dec. 6-8, Pp. 123.
5.
Hirpara, D. G.; Gajera, H. P.; Vaja, K. N.; Patel, D. S. and Golakiya, B. A. (2016). GC-MS based characterization of bioactive constituents attained from Trichoderma biocontrol agent inhibiting Sclerotium rolfsii in groundnut. International Conference on "Nutraceuticals and Functional Foods- The Challenges and Opportunities”, Anand, AAU, Dec. 6-8, Pp. 124.
6.
Gajera, H. P.; Savaliya, D. D.; Vaja, K. N. and Golakiya, B. A. (2016). Biochemical characterization of phosphate solubilizing bacteria isolated from soil rhizosphere. International Conference on "Nutraceuticals and Functional Foods- The Challenges and Opportunities”, Anand, AAU, Dec. 6-8, Pp. 128.
7.
Rathod, V. B.; Solanki, H. V.; Gajera, H. P.; Mehta, D. R. and Golakiya, B. A. (2016). Genetic variability and divergence for oil content and yield attributes in Indian mustard [Brassica juncea (L.) CZERN & COSS]. International Conference on "Nutraceuticals and Functional Foods- The Challenges and Opportunities”, Anand, AAU, Dec. 6-8, Pp. 176.
8.
Vaja, K. N.; Gajera, H. P.; Vaja, V. N. and Golakiya, B. A. (2016). Nutritional quality and genetic diversity related to salinity tolerance in wheat genotypes. International Conference on "Nutraceuticals and Functional Foods- The Challenges and Opportunities”, Anand, AAU, Dec. 6-8, Pp. 177.
9.
Katakpara, Z. A.; Gajera, H. P.; Dabhi, K. H. and Golakiya, B. A. (2016). Assessment of seed quality and microsatellite markers for heat tolerance in bread wheat (Triticum aestivum L.). International Conference on "Nutraceuticals and Functional Foods- The Challenges and Opportunities”, Anand, AAU, Dec. 6-8, Pp. 191.
10.
Vaja, K. N.; Gajera, H. P.; Hirpara, D. G. and Golakiya, B. A. (2016). Molecular diversity of Pseudomonas contributed to PGPR and biocontrol activity against phytopathogens. International Conference on "Nutraceuticals and Functional Foods- The Challenges and Opportunities”, Anand, AAU, Dec. 6-8, Pp. 192
11.
Gajera, H. P.; Bhadani, R. V.; Patel, S. V. and Golakiya, B. A. (2016). Genetic diversity analysis among promosing genotypes and cultivars of cowpea (Vigna unguiculata L.) using molecular markers. International Conference on "Nutraceuticals and Functional Foods- The Challenges and Opportunities”, Anand, AAU, Dec. 6-8, Pp. 192.
12.
Savaliya, D. D.; Katakpara, Z. A.; Gajera, H. P. and Golakiya B. A. (2016). Influence of brassinolide on isozymes profiling and seed quality of groundnut (Arachis hypogaea L.) cultivars under water deficit stress. International Conference on "Nutraceuticals and Functional Foods- The Challenges and Opportunities”, Anand, AAU, Dec. 6-8, Pp. 193.
13.
Marviya, G.V.; Kandoliya, U. K.; Golakiya, B. A. and Vakharia, D. N. (2016). Role of Benzyl Adenine on Enzyme Activities in Pearl Millet [Pennisetum Glaucum (L.) R.Br.] Genotypes under PEG Induced Stress', in InternationalConferenceon “NutraceuticalsandFunctionalFoods:The ChallengesandOpportunities” (ICNFF-16-ISAB) along withXIIIConvention  oftheIndianSocietyofAgriculturalBiochemists  during December6to8,2016 at Department   ofBiochemistry, B.A.CollegeofAgriculture,   Anand  Agricultural   University,Anand-388110,INDIA.  Abstrct in ICNFF-2016-ISAB, P.224-225.
14.
Kandoliya, U. K.; Marviya, G. V.; Rathod, P. J.; Vakharia, D. N. and Golakiya, B. A. (2016). Pathogenesis related hydrolytic enzymes induction in response to PGPR seed priming against wilt pathogen (Fusarium oxysporum f.Sp. Ciceri) in Chickpea., in InternationalConferenceon “NutraceuticalsandFunctionalFoods:The ChallengesandOpportunities” (ICNFF-16-ISAB) along withXIIIConvention  oftheIndianSocietyofAgriculturalBiochemists  during December6to8,2016 at Department   ofBiochemistry, B.A.CollegeofAgriculture,   Anand  Agricultural   University,Anand-388   110,INDIA.  Abstrct in ICNFF-2016-ISAB, P.224-225
15.
Chahwala, F. D.; Tomar, R. S.; Padhiyar, S. M.; Kheni, J. and Desai, H. (2019). presented paper at 9th International Geminivirus Symposium and 7thInternational ssDNA Comparative Virology Workshop on “Exploration of defence mechanism involved in solanum lycopersicum by using high throughput RNA-Seq method against begomovirus infection.” at UC Davis, Davis, California, USA form 9th November to 13th November 2019 with the funding from DBT.
16.
Tomar, R. S. (2019). presented a paper on “Partial genome and transcriptome sequencing in minor millets for the discovery of SSR and EST-SSR markers” at National Institute of Plant Genome research (NIPGR), New Delhiin a National Conference on “Neglected and Underutilized Crop Species” held on  August 2nd, 2019.
17.
Desai, H.; Padhiyar, S. M.; Humbal, N. V.; Meniya, V. H.; Bhut, N.; Kheni, J.; Chahwala, F. D. and Tomar, R. S. (2019). presented a poster on “Genetic diversity in the minor millet germplasms revealed by simple sequence repeat markers” at National Institute of Plant Genome research (NIPGR), New Delhiin a National Conference on “Neglected and Underutilized Crop Species” held on  August 2nd, 2019.
Other Publication viz Books, Book chapter, Practical Manuals, Bulletins etc.
Sr. No.
Details of Publication
Year 2015-16
1.     
Gajera, H. P.; Patel, S. V. And Golakiya, B. A. (2015). Biochemistry, Molecular Biology and Biotechnology - Instant Notes. New India Publishing Agency, New Delhi, pp. 372, ISBN: 978-93-83305-52-0.
2.     
Antala, T. J.; Gajera, H. P. and Vyas, H. R. (2015). Molecular and Biochemical marker for Fingerprinting: Cowpea. LAP lambert Academic Publishing, Deutschland/Germany, ISBN: 978-3-659-23612-0.
3.     
Gajera, H. P.; Kapopara, M. B. and Antala, T. J. (2015). Peanut Butter: Nutritional Concepts to Fortify Confectionaries. LAP lambert Academic Publishing, Deutschland/Germany, ISBN: 978-3-659-38919-1.
4.     
Gajera, H. P.; Savaliya, D. D. and Antala, T. J. (2015). Eugenol: Therapeutic Potential of Tulsi (Osimum sanctum L.) LAP lambert Academic Publishing, Deutschland/Germany, ISBN: 978-3-659-51337-4.
5.     
Gajera, H. P.; Dave, R. A. and Chavda, J. S. (2015). Curcuminoids: Antioxidant Potentials and Medicinal Uses.LAP lambert Academic Publishing, Deutschland/Germany, ISBN: 978-3-659-53422-5.
6.     
Gajera, H. P.and Golakiya, B. A. (2015). In: Raghvani, K. K.; Jethva, D. M. and Vyas, U. M. (Eds.) Biochemical and Molecular Basis of Plant Defense Mechanism Induced by Biocontrol agent.On line E-Manual Designed and Developed By Division of Computer Applications, IARI, New Delhi, on CBP-IASRI portal, pp. B-17-25. (http://http://cbp.icar.gov.in/ebook22.aspx?trainingApprovedId=WS-2015-1085)
7.     
Kandoliya, U. K. and Golakiya, B. A. (2015). In:Raghvani, K. K.; Jethva, D. M. and Vyas, U. M (Eds.). Role of secondary metabolites in plant pathogenesis and Defense mechanism. On line E-Manual Designed and Developed By Division of Computer Applications, IARI, New Delhi, on CBP-IASRI portal, pp. B-1-9. (http://http://cbp.icar.gov.in/ebook22.aspx?trainingApprovedId=WS-2015-1085)
8.     
Marviya, G. V. and Golakiya, B. A. (2015). In: Raghvani, K.K.; Jethva, D.M. and Vyas, U.M. (Eds.) DNA Isolation and Utilization of Biotechnological Methods viz. SSR, RAPD etc. For Identification, Comparison and Sequencing of Genes. On line E-Manual Designed and Developed By Division of Computer Applications, IARI, New Delhi, on CBP-IASRI portal. pp. B-26-43.
         (http://http://cbp.icar.gov.in/ebook22.aspx ?trainingApprovedId=WS-2015-1085)
9.     
Gajera, H. P. (2015). Practical manual for Basic Biochemistry. Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh.
10. 
Marviya, G. V.; Rathod, P. J. and Kandoliya, U. K. (2015).  Practical manual on Elementary plant Biochemistry and Biotechnology. Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh.
11. 
Marviya, G. V. (2015). Practical manual on Fundamentals of Food Technology. Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh.
12. 
Rathod, P. J.; Kandoliya, U. K. and Marviya, G. V. (2015). Practical manual on Biochemistry. Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh.
13. 
Rathod, P. J. (2015). Food & Nutritional Biochemistry. Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh.
14. 
Rathod, V. B. (2015). Lecture Notes and Practical manual on Principles of plant Breeding. Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh.
Year 2016-17
1.     
Bajaniya V. K.; Bhadja N. V. and Kandoliya U. K. (2016). Physicochemical and Fatty acids Properties of Bili and Khakhara oils. LAP Lambert Academic Publishing, ISBN. No. 978-3-659-89879-2.
2.     
Hirpara, D. G.; Gajera, H. P. and Patel, A. K. (2016). Molecular perspectives of Trichoderma strains inhibiting S. rolfsii. LAP Lambert Academic Publishing, ISBN: 978-3-330-00541-9.
3.     
Gajera, H. P.; Savaliya, D. D.; Hirapara, D.G.; Patel, S.V.  and Golakiya, B. A. (2016).  In: Kumar, P.; Gupta, V. K.; Tiwari, A. K. and Kamale, M. (Eds.). Biocontrol Mechanism of Bacillus for Fusarium Wilt Management in Cumin (Cuminum cyminum L.).(Book chapter in Current trends in plant disease diagnostics and management practices.) Springer Nature, Ag Switzerland, pp. 29-47,  ISBN No.  978-3-319-27312-9. DOI: 10.1007/978-3-319-2732-9
4.     
Rathod, P. J.; Marviya, G. V. and Kandoliya, U. K. (2016). Practical manual on Advances in biochemistry and Biotechnology of flower crops. Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh.
5.     
Vala, A. G. and Marviya, G. V. (2016). Practical manual For ELP of tissue culture technology. Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh.
6.     
Marviya, G. V. (2016). Fundamentals of Food and Nutrition. Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh.
7.     
Parakhia, M. V. (2016). Practical Manuals on Introductory Microbiology. Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh.
8.     
Rathod, V. B. (2016). Lecture Notes on Molecular Breeding. Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh.
9.     
Rathod, V. B. (2016). Practical manual on Techniques in Molecular Biology-II. Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh.
10. 
Gajera, H. P.; Kandoliya, U. K. and Golakiya, B. A. (2016). Detection of Adulteration and Microbial contaminants in Milk And Milk Products. Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh.
Year 2017-18
1.     
Gajera, H. P. (2017). Practical manual for Basic Biochemistry. Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh.
2.     
Rathod, P. J. (2017). Biochemistry of Cereals oilseeds and pulses Fundamental of Food and Nutritional Biochemistry, Advances in Biochemistry and Biotechnology of flower crops, Advances in Biochemistry and Biotechnology of vegetables crops. Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh.
3.     
Hirpara, D. G. and Gajera, H. P. (2017). Quorum Sensing Enables Bacteria to Communicate, Readers shelf, 13(11): 53-55.
4.     
Hirpara, D. G. and Gajera, H. P. (2017). Dynamics of Nanobiotechnology for Protection and Nutrition of Crop Plants, Readersshelf, 12: 39-41.
5.     
Rathod, V. B.; Rathod, P. J. and Katakpara, Z. A. (2017). Union budget: 2017-2018 - Budget for better agriculture. Indian Farmer, 4(10): 760-762.
6.     
Hirpara, D. G. and Gajera, H. P. (2018). Quorum Quenching: Implications of Novel Antimicrobial Therapeutics to Control Infectious Diseases, Readersshelf, 14(05): 04-06.
Year 2018-19
1.     
Gajera, H. P. (2018). Practical manual on principle of Biotechnology. Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh.
2.     
Vala, A. G. and Parakhia, M. V. (2018). Practical manual on  introductory biotechnology. Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh.
Year 2020-21
1.
Riddhi Rajyaguru, Nataraja Maheshala, Chandrashekar Mootapally, Neelam Nathani, Rukam Singh Tomar, Hiren Bhalani, Priyanka Sharma (2021). CRISPR-Cas9 Approaches to Enhance Contents of Plant Secondary Metabolites. In: Mohd. Shahnawaz (ed), Biotechnological Approaches to Enhance Plant Secondary Metabolites: Recent Trends and Future Prospects, CRC Press, Taylor & Francis Group, USA. 
2.
Vishnu D Rajput, Abhisek Singh, Ragini Sharma, Sapna Rawat and Rukam S. Tomar (2021). Impact of emerging tools for solving 'Hidden hunger' in Humans. In: Vishnu D Rajput & Abhishek Singh (eds.), Emerging Tools for Sustainable Agriculture and Food Security. Nova Science Publishers, Inc.
3.
Abhisek Singh, Vishnu Rajput, Sapna Rawat and Rukam S. Tomar (2021). Emerging tools for sustainable agriculture and food security. In: Vishnu D Rajput & Abhishek Singh (eds.), Emerging Tools for Sustainable Agriculture and Food Security. Nova Science Publishers, Inc.
4.
Zahra Ghorbanzadeh, Feba Jacob Thoppurathu, Rasmieh Hamid, Rukam S. Tomar and Mohammad Reza Ghaffari (2021). Biotechnology and Genetic engineering tools for abiotic stress management. In: Vishnu D Rajput & Abhishek Singh (eds.), Emerging Tools for Sustainable Agriculture and Food Security. Nova Science Publishers, Inc.  
5.
Sara Asadi, Feba Jacob, Rasmieh Hamid, Rukam S. Tomar and Zahra Ghorbanzadeh (2021). Advance Microbiological Applications For Sustainable Agriculture. In: Vishnu D Rajput & Abhishek Singh (eds.), Emerging Tools for Sustainable Agriculture and Food Security. Nova Science Publishers, Inc.  
Year 2021-22
1.
Riddhi Rajyaguru, Nataraja Maheshala, Chandrashekar Mootapally, Neelam Nathani, Rukam Singh Tomar, Hiren Bhalani, Priyanka Sharma (2021). CRISPR-Cas9 Approaches to Enhance Contents of Plant Secondary Metabolites. In: Mohd. Shahnawaz (ed), Biotechnological Approaches to Enhance Plant Secondary Metabolites: Recent Trends and Future Prospects, CRC Press, Taylor & Francis Group, USA. 
2.
Rathod P.J. (2021). Practical Manual for Biochem 509 Food and Nutritional Biochemistry, Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh
3. Rathod P.J. (2021). Practical Manual for Biochem 511 Biochemistry of cereals , oilseeds and pulses, Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh
4. Rathod P.J. (2021). Practical Manual for Biochem 509 Nutritional Biochemistry (5th dean), Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh
5. Sara Asadi, Feba Jacob, Rasmieh Hamid, Rukam S. Tomar and Zahra Ghorbanzadeh (2021). Advance Microbiological Applications For Sustainable Agriculture. In: Vishnu D Rajput & Abhishek Singh (eds.), Emerging Tools for Sustainable Agriculture and Food Security. Nova Science Publishers
Year 2022-23
1. Rie Horiuchi, Ram B. Singh, Toru Takahashi, Saikat Kumar Basu, Rukam S. Tomar, Wajdy Al-Awaida, Harpal S. Buttar and Miki Tokunaga (2022). Epigenetic modulation of nutritional factors with reference to microgravity conditions for plants and animals: a new biotechnological approach for developing functional foods. In: Ram B. Singh, Shaw Watanabe, and Adrian Isaza (eds.), Functional foods and nutraceuticals in metabolic and non-communicable diseases. Academic Press, Elsevier Inc. (ISBN: 978-0-12-819815-5).
2. Rathod P.J. (2022). Practical Manual forUG Horticulture course PHT1.1  Food and Nutrtion, Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh
3. Rathod P.J. (2022). Practical Manual for UG Agriculture course Fundamentals of plant biochemistry(Biochem2.1), Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh
4. Richa Mishra, Abhishek D. Tripathi, Ram B. Singh, Douglas W. Wilson and Rukam S. Tomar (2022). Estimates of functional food and nutraceutical availability in the world, with reference to food peroxidation and food safety. In: Ram B. Singh, Shaw Watanabe, and Adrian Isaza (eds.), Functional foods and nutraceuticals in metabolic and non-communicable diseases. Academic Press, Elsevier Inc. (ISBN: 978-0-12-819815-5).
Year 2023-24
1.
Shital M. Padhiyar, Jasminkumar Kheni, Shraddha B. Bhatt and Rukam Singh Tomar* (2024). Genetic Improvement of Barnyard Millet Through Advanced Biotechnological Methods. In: Sweta Mishra, Shailesh Kumar & R C Srivastava (eds), Genetic Improvement of Small Millets.Springer Nature Singapore Pte Ltd., Singapore 189721, Singapore.
2.
Riddhi H. Rajyaguru, Nataraja Maheshala, Priyanka Sharma, Hiren Bhalani and Rukam Singh Tomar* (2024) Genetic Improvement of Foxtail Millet Through Advanced Biotechnological Methods. In: Sweta Mishra, Shailesh Kumar & R C Srivastava (eds), Genetic Improvement of Small Millets. Springer Nature Singapore Pte Ltd., Singapore 189721, Singapore.
3.
Jasminkumar Kheni and Rukam S. Tomar*(2023). Nutraceutical Usages and Nutrigenomics of Castor. In: Chittaranjan Kole (Eds): Compendium of Crop Genome Designing for Nutraceuticals. Springer-nature, Berlin, Germany.
4.
Zahra Ghorbanzadeh, Rasmieh Hamid, Mohammad Reza Ghaffar, Bahador Maleknia, Rukam S. Tomar, and Feba Jacob Thoppurathu (2023) Bio-Nanotechnological Methods in Crop Production and Pest Management. In: Vishnu D. Rajput, Abhishek Singh, Tatiana Minkina, Krishan Verma and  Awani Kumar Singh (eds), Nanotechnology for Sustainable Agriculture: An Innovative and Eco-Friendly Approach. CRC Press, Taylor & Francis Group, USA.
5.
Balaji Rathod, Shashikant Sharma, Khyati R. Savani, Devendra Kumar, Mansi Barot and Rukam Singh Tomar* (2023).  Role of Genetic Engineering in Male Sterility for Hybrid Seed Production. 
6.
Balaji Rathod, Shashikant Sharma, Devendra Kumar, Khyati R. Savani, Mansi Barot and Rukam Singh Tomar* (2023). Transcript and Protein Analysis.
7.
Zahra Ghorbanzadeh, Rasmieh Hamid, Feba Jacob, Rukam Singh Tomar (2023). Coriander transcriptome: Trends, Scope, and Utilization for Coriander Improvement. In: Handbook of Coriander (Coriandrum sativum), Taylor & Francis Group, LLC, Abingdon, England
8.
Zahra Ghorbanzadeh, Rasmieh Hamid, Feba Jacob Thoppurathu, Rukam S. Tomar and Bahador Maleknia (2023). Biotechnological Methods In: Pest Management For Sustainable Agriculture. In: Vishnu D Rajput & Abhishek Singh (eds.), Emerging Tools for Sustainable Agriculture and Food Security. Nova Science Publishers, Inc., Hauppauge, NY, 11788 USA
9.
Rathod P.J. (2023). Practical manual for Advances in Enzymology , Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh
10.
Rathod P.J. (2023). Practical manual Biotechnological approaches for vegetable crops, Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh
11.
Rathod P.J. (2023). Practical Manual for Fundamental of Plant Biochemistry, Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh
12.
Ashish vala (2023) From DNA to dinner plate: unraveling the biotechnological marvels of sustainable agriculture
13.
Ashish Vala (2023) Harvesting Intelligence: Transforming Agriculture through Artificial Intelligence
14.
Dr. Jay Khaniya (2024). The Future of Plant Breeding: Innovations Driving Agricultural Revolution. Agri Articles, 04(01): 598-601. 
15.
Dr. Jay Khaniya (2024). Revolutionizing Agriculture: Unveiling the Power of Pigeonpea (Cajanus cajan (L.) Mill Sp.) for sustainable Farming and Food Security. Agri Articles, 04(02): 37-42. 
16.
Dr. Jay Khaniya (2024). Groudnnut Farming in a Changing Climate: Building Resillience for Sustainable Agriculture. Agri Articles, 04(02): 75-79.
17.
Dr. Jay Khaniya and Dr. A. J. Barad (2024). Smart Farming, Smart Greenhouse & Precision Agriculture, Nutri-sensitive Agriculture. Current Trends in Agriculture & Allied Sciences, 3: 748-755.
Year 2024-25
1.
Dhawale R.N., Padhiyar S.M., Bhatt.S.B. (2024). Genome editing through CRISPR-CAS9for improvement of livestocks. ISBN: 978-81-976079-7-4
2.
Bhatt S.B., Dhawale R. N. (2024). Microbial Genetics observation system. ISBN: 978-81- 976079-7-4
3.
Bhatt S. B., Dhawale R. N. (2024). Environmental Microbiology Detection system. ISBN: 978-81- 976079-7-4
4.
Bhatt S. B., Dhawale R. N. (2024). Application of Industrial Microbiology. ISBN: 978-81- 976079-7-4
5.
Bhatt S. B., Dhawale R. N. (2024). Bacteriology Analysis system. ISBN: 978-81- 976079-7-4
6.
Bhatt S. B., Dhawale R. N. (2024). Virology Detection Technology.ISBN:978-81- 976079-7-4
7.
Dr. Jay Khaniya (2025). Importance of Preserving Landraces in Modern Crop Breeding. Agri Articles, 05(01): 262-264.
8.
Dr. Jay Khaniya (2025). Big Data and Breeding: Revolutionizing Crop Improvement. Agri Articles, 05(01): 265-267.
Recommendations for scientific community (in brief with title) / Patent
Year 2015-16
1.      QTL Mapping and development of SCAR marker for Fusarium wilt (Fusarium oxysporum f. sp. ricini) in castor (Ricinus communis).
       The scientific community involved in castor improvement are recommended to use below mentioned JAUC series of primers to transfer resistance toward fusarium wilt into the new genotype through Marker Assisted Selection (MAS) or Marker Assisted Backcrossing (MAB). 
Sr. No.
Primer name
Sequence
Product Length
1
JAUC1F
CAATGTCGAGCATAGCTGCC
312
 
JAUC 1R
ACAATTGGCGAAGCAAGCTG
2
JAUC 2F
GTCGAGCATAGCTGCCAACA
166
 
JAUC 2R
ACGTTCAGCCAACAAAAGCC
3
JAUC 3F
TGTCGAGCATAGCTGCCAAC
853
 
JAUC 3R
ATGCCACCTCCAGCATACAC
4
JAUC 4F
GTCAATGTCGAGCATAGCTGC
389
 
JAUC 4R
GGTCCCTGATTACCAGACGC
5
JAUC 5F
AATGTCGAGCATAGCTGCCAA
864
 
JAUC 5R
TCACTAGCAATGCCACCTCC
2.   Sex determination of papaya (Carica papaya) through Molecular characterization.
      The scientific community involved in papaya improvement are recommended to use below mentioned JAUP series of primers to determine pre-flowering stage sexuality in ‘Madubindu’ variety of  papaya. 
Sr. No.
Name of Primer
Primer Sequence
Product Length
1
JAUP1F
GCGTTTCGAGGAGATGGTCA
410
 
JAUP 1R
ACCTAACAAACTTGGCTGGC
2
JAUP 2F
TTTATTTCTTTCGGCTGCGGG
782
 
JAUP 2R
AGCTGCTTCTTCACGCTCAT
3
JAUP 3F
ACCCTCGGAAACAGGACAAG
427
 
JAUP 3R
TTGGCATAACGGGTGTTGGA
4
JAUP 4F
CCGCTCCCTCTTTTTCTGGT 
487
 
JAUP 4R
ACATGCAAGAGTGTAGCGCA
3.   QTL Mapping and development of SCAR marker for Macrophominaroot rot in castor (Ricinus communis).
      The scientific community involved in castor improvement are recommended to use below mentioned JAUC series of primers to transfer resistance toward root rot into the new genotype through Marker Assisted Selection (MAS) or Marker Assisted Backcrossing (MAB). 
Sr. No.
Primer
Sequence
Product Length
1
JAUC6F
TGGTATTCGGGGCAGGAATG
851
 
JAUC 6R
GAAAGCCCTCTGCCATCCAT
2
JAUC 7F
GTGGGCATGGGTGGTATAGG
622
 
JAUC 7R
CGCTCACCAAGTCCCACATA
3
JAUC 8F
GTCTATGGATGGCAGAGGGC
345
 
JAUC 8R
TCCAGGAAGGCGAGCTATCA
4
JAUC 9F
GATGCCCTTGGGCTAAGCAT
157
 
JAUC 9R
AGCCATTGCAATCGGTCTGA
5
JAUC 10F
GGGGCAGGAATGAGGACAAG
97
 
JAUC 10R
CCTATACCACCCATGCCCAC
Year 2016-17
1.      Biochemical and molecular characterization of phosphate solubilizing bacteria from different soil rhizosphere.
        It is informed to scientific community that among 17 PSBs, isolate derived from chickpea rhizosphere exhibited highest phosphate solubilizing index followed by isolates from pigeonpea rhizosphere and poultry farms. The best PSBs were confirmed as Pseudomonas putida and Pseudomonas fulva.    
Year 2017-18
1.       Development of cultivar specific markers for the hybrids released by JAU in pearl millet.
The scientific community involved in pearl millet improvement are recommended to use below mentioned JAUB series of primers for the identification of hybrids. 
Primer Name
Primer Sequence
Product Length
Hybrid
JAUB5F
CTGCTTCTTCTCGTAAT
941
GHB 538
JAUB5R
TTCGCCAGGAGGGCGT
 
 
JAUB7F
ATCGCTACGTCTACGATG
527
GHB 558
JAUB7R
TCTCCGATTAGGTCGTTG
 
 
JAUB17F
TACCTTTGTGTTGATGGTTT
415
GHB 577
JAUB17R
CTACTCTTGTTCCTCCTCT
 
 
JAUB10F
CAACATACCTCTCGTACGGT
1020
GHB 719
JAUB10R
TTTTCGGATAGTTCAAACAGT
 
 
JAUB1F
TAGCTGGGTAGAGGCTGACT
249
GHB 526
JAUB1R
GCCTGTTGACAGTCCGTAGA
 
 
JAUB22F
CGCAGTGGATTATCCCTCTC
354
GHB 732
JAUB22R
GGATGACCCTCGAAACCATA
 
 
JAUB24F
GGCATCTCGTTGTACCTCGT
339
GHB 744
JAUB24R
AACAGCATCAGAGCGGACTT
 
 
JAUB27F
CTTGTGCCTTGGAGCTGTTT
550
GHB 757
JAUB27R
GTGGCTGTTGTCATGAATGC
 
 
JAUB30F
TTAGCATTTTGCGCTTTGTG
250
GHB 905
JAUB30R
GCATGAATCAGCCCATACAA
 
 
JAUB15F
TGTGTTCTAATGTGCTATGTA
330
GHB 941
JAUB15R
CACTAAGCTTCATGACGTGAT
 
 
2.    Development of cultivar specific markers for the varieties released by JAU in Groundnut
       The scientific community involved in Groundnut improvement are recommended to use below mentioned JAUG series of primers for the identification of groundnut varieties.
Primer Name
Primer Sequence
Product Length
Variety
JAUG12F
CACCAAGTGGGAGAGGAAAA
352
GJG 22
JAUG12R
CCAACACTACCCCATTCTGG
 
 
JAUG13F
GTGGCCAAAGATTTCACACA
1201
GJG 17
JAUG13R
GTCCGATGGCAGCTCTATGT
 
 
JAUG1F
GTCGATGAGACGGCTAGTGG
348
GJG 31
JAUG1R
TCGTGACGAGGGTGATCTCT
 
 
JAUG17F
TCGGGATGTGTTTATGTTGC
386
GJG 9
JAUG17R
GGAGTTCGCACATTGTGTTG
 
 
JAUG20F
GCTGGTTAGTTGTGCGGATT
409
GJG HPS 1
JAUG20R
CTCCCCCTTATTGGATAGGC
 
 
JAUG22F
CGAGTATCCCGAACCCTACA
265
GJG 20
JAUG22R
AAAAGGGTTGGTTTCGCTTT
 
 
JAUG4F
CGCACGCATGCCCTAAATAC
355
GG 5
JAUG4R
TTGGGTGCGGATGAGAAAGG
 
 
JAUG26F
TGAGGATTTGCCGTTTCTTT
405
GJG 7
JAUG26R
CCCGTCCCCAAATGATAGAT
 
 
JAUG8F
AAACCGCTGTGTCTCTCTGC
329
GG 11
JAUG8R
GCCTGTTGACAGTCCGTAGA
 
 
3.   Biochemical and molecular characterization of brinjal varieties and promising genotypes
      It is recommended to the scientific community that the most diverse varieties were found to be GOB-1 and JBGR-1 compared to the other promising genotypes and varieties based biochemical, nutritional analysis. The diverse GOB-1 contained higher protein, total soluble solids, soluble sugars, phenols, ascorbic acid, PPO activity and flavanoid content and lower in glycoalkaloids and acidity. The clustering pattern on the basis of molecular analysis (SSR) depicting diverse varieties GOB-1 and GJB-3 out grouped from other genotypes with 48 % similarity. 
4.   Genome sequencing of pathogenic Macrophomina phaseolina isolated fromcastor.
      It is recommended to the scientific community involved in castor  improvement that the sequencing of plant pathogenic fungi Macrophomina phaseolina showed  the size of genome is 98.6 Mb. The draft genome having 3061 contings, 30756 genes, 183303 exon, 28096 SSR and 13947 repeat region present in the genome. In genome 24.30 % of genes involve in molecular function, 34.27% of genes involve in cellular component and 41.43% of genes involve in biological process. pathogenicity related genes identified in this study have high relevance in future fungicide designing and following primers will be used for the specific identification of pathogenic fungi Macrophomina phaseolina.
Name
Primer 3'-5'
Product length
GC%
Tm
JAUMPF1
GGAGAGTTTGCGTCAAGTCC
202
55
59.85
JAUMPR1
ACTGTCGGAGAAACCGAAGA
50
59.84
JAUMPF2
GCGAACTCAATCCCAACATC
226
50
60.47
JAUMPR2
TCGACCATGAGGGTTTTCTC
50
60.05
JAUMPF3
CGCACTAATAATCGGCCCTA
193
50
60.07
JAUMPR3
GTAAAAGTGCGTTGGCGTTT
45
60.17
5.   In situdetection of potassium status in cotton plants
      It is recommended to the scientific community that silver and carbon nanoparticles based nano-biosensor developed for detection of potassium deficiency directly from the leaf sap of plants. The nano-biosensor works on the basis of ion-selective mechanism to detect potassium ion in the range of 10 mM to 120 mM. The deficiency of potassium below threshold line of 40 mM from sap with the sensor display indicating the voltage output below (-ve) 15 mV will be signaled. The onetime cost of the developed nano-biosensor is about Rs. 2500-3000 and worked to detect potassium deficiency level at any growth stage of cotton crop.
Year 2018-19
1.     Draft genome sequencing and analysis of fungal phytopathogen Sclerotium rolfsii to reveal insight into its genetic structure.
        It is recommended to the scientific community involved in Groundnut  that the sequencing of plant pathogenic fungi Sclerotium rolfsii showed  the size of genome is 73 Mb. The draft genome having 8919 contings, 16830 genes and11171 SSR present in the genome. In genome 3507 and 261 genes involve in Transporter and catalytic function respectively , 1571 genes involve in  cellular component and 709 of genes involve in  biological process. pathogenicity related genes identified in this study have high relevance in future fungicide designing and following primers will be used for the specific identification of pathogenic fungi Sclerotium rolfsii.
Name
Primer 3'-5'
Product length
GC%
Tm
JAUSRF1
GAAGAGTTTGCGTCGAGTCC
250
55
59.85
JAUSRR1
GCTGTCAGAGAAACCGAAGA
50
59.84
JAUSRF2
ACGAACTCGATCCCAGCATC
170
50
60.47
JAUSRR2
TCGATTATGAGGGTTTCCTC
50
60.05
JAUSRF3
CGGACTAATAATCGACCCTA
230
50
60.07
JAUSRR3
ATAAAGGTGCGTTGACGTTT
45
60.17
Year 2019-20
1.     Qualitative and nutritional evaluation of promising genotypes of groundnut.
       The scientific communities involved in groundnut improvement are recommended to use below mentioned groundnut genotypes for the qualitativeand nutritional improvement of groundnut crop.
 
Trait for improvement
 
Name of genotype
1
Total Carbohydrate
:
GG-16, KDG-123, GG-4, RG-578
2
Total Soluble Sugar
:
TG-51, ICGV-00440, JL-501
3
True Protein
:
RG-510, TG-51, TG-37
4
Total Oil
:
TLG-45, J SSP-35, ICGV-86156, GG-20
5
Iron
:
JL-501, ICGV-91114, AG-2006-6
6
Calcium
:
GJG-9, ICGV-02266, TPG-41, GJG-17
7
Oleic Acid
:
ICGV-15055, ICGV-15050, ICGV-15035
8
O/L ratio
:
ICGV-15035, ICGV-15033, Sunoleic
2.      Phytochemical, antioxidant and antidiabetic characterizations of custard apple (Annona squamosa L.) genotypes
         It is informed to the scientific community that fruit pulp of custard apple genotypes DS-1, Aml-10 and Aml-6 acquired higher antidiabetic potential (as α amylase inhibition) and antioxidant activity (as % DPPH free radical scavenging). The ascorbic acids and phenols contributed positively for both antidiabetic and antioxidant potentials in fruit pulp of custard apple. Phytochemicals analysis illustrated that terpenoids and flavonoids present in fruit pulp are positively correlated with antioxidant activity and that of alkaloids contributed significantly positive correlation for antidiabetic potential.
Year 2020-21
1.     Studies on Phytochemicals And Metabolomics Profiling of Seaweeds
        The seaweed resources viz., Green, Red and Brown seaweeds analyzed through MS/MS based platform showed presence of 375 unique compounds. These seaweeds were found to contain important oil content, vitamin D3 and many 
bioactive compounds that can be used as nutraceutical products. In case of ω-3 polyunsaturated fatty acids, eicosapentaenoic acid (EPA) was found in seaweed species, viz., Sarconema filiforme(5.02%) and Spatoglossum asperum(4.04%).
Vitamin D-3 was found in Caulerpa Lenthilifolia(16.7%), Caulerpa sertulorioides(8.5%), Ulva fasciata(10.7%), Halimeda tuna(12.7%), Hydroclatharus clathratus(18.9%), Halymenia venusata(6.5%), H. porphyraeformis(20.6%), Dictyopteris marginatum, Gelidiopsisrepens(18.2%) and Heterosiphonia muelleri(26.1%). Some species of seaweeds viz, Dictyopterisdelicatula(2.68%), Heterosiphonia muelleri(0.24%), Dictyopterismarginatum (stoecospermum) (4.07%), Spatoglossum asperum(8.1%), Padina gymnospora (4.86%), Caulerpa lenthilifolia(0.96%) contained docosahexaenoic acid (DHA). These compounds are notfound in plants.
2.     Transcriptome and Proteomic Characterization for Identification of Candidate
        Genes Responsible for Pistillate Inflorescence and Its Reversion in Castor The scientific community involved in Castor improvement are recommended to use the set of 14 primers as mentioned below to distinguish the pistillate and monoecious plants in castor. They are also advised to use the castor database developed (http://webtom.cabgrid.res.in/castdb/) for the identification of gene of interest and selection of SSRs and their primers to be used under Marker Assisted Selection and molecular breeding.
Sr.  No
Name of the gene
Gene
Forward primer
Reverse Primer
Gene Function
1
Dynamin-2A
GCTAAGCAAGGGTTCGTCAG
CTGGCAGGTCGATCAATTTT
Response to hormone stimulus
2
Auxin response factor
CACACATGGTGG
G TT CTCAG
TGAGTTGGTGGTTGCA
TTGT
Organ development; and post-embryonic development
3
ATP-binding
protein
CATTGGACAGGT
CCT CCACT
AAGCAAGGTGAAGCA
AGGAA
Regulation  of  ARF protein  signal transduction
4
Spermidine
synthase
GGTGCTGCATTTC
TC TCCTC
TGCCCTGGAATAAATC
TTGC
Polyamine biosynthetic process
5
Xaa-pro amino
peptidase
GGATGGAAGCTTT
GG CATAA
GCCCTTCTCACCAAAA
TTGA
Auxin transport
6
Conserved
hypothetical protein
TCGAATGAAGAG
GCC ATTCT
GTGAGAAGGGCAAAA
GCAAG
Abscisic  acid
metabolic process
7
MADS box
protein
AAAGGTTGGCCTG
A GGAGTT
GTCACTTGCCTGTTGC
TTGA
Transcription,
DNA-dependent
8
RNA polymerase
sigma factor rpoD1
GATCTTCAGGCAA
G CACTCC
ATATCCTCCCCTTGGT
C CAC
DNA-dependent
transcription, initiation
9
Protein with
unknown function
TTGTCAAGGGCCA
G TTCTTT
TTGACCTGCTGTGTCC
C ATA
Guanylribonucleoti
de binding
10
Arginine/serine-
rich splicing factor
CGGAAGCTTGATG
A CACTGA
GGCTTCTACTTCGGCT
C CTT
Sex differentiation
11
Acid phosphatase
TCCTGTAACCGTT
CC TTTCG
TGTTCAGGCTCGAAAC
CTCT
Phosphatase activity
12
DNA replication
helicase dna2
AGGCTGTGAATA
ACC CAACG
CCCAATATCTTCGCCT
T GAA
DNA        metabolic
process
13
Eukaryotic
translation initiation factor2c
CACGACTTTTTCC
CG TTGAT
GAACTCCCTCTGGTGG
CATA
Translation
14
s-adenosyl-
methyltransferase
TCTCCGTTCTTTC
GT CGATT
GGGTCAACATCCATTC
CAAC
rRNA methylation
3.     Genome Sequencing of Cumin (CuminumcyminumL.) to Reveal Insight of its Genomic Architecture
        The scientific community involved in Cumin improvement are recommended to use genomic information generated   (https://drive.google.com/file/d/ 1ukln R77lYWJcR Ip8m40lLpm OP_ujqJz/view ?usp=sharing)for cumin in Marker Assisted Selection for the improvement of cumin. They are also advised to use the genes identified as mentioned below and SSRs identified in Marker Assisted Selection.
Sr. No.
Character
Number of genes
Gene identified
 
1
Flavonoid        
21
U78D2,   C75A2,  75A4,  C75B3,   C93C F3PH,  FAOMT,  FL3H3, MOMT,  SOMT SOT5,  UFOG,  UFOG1, UFOG2, UFOG UFOG4, UFOG5, UFOG6, FOG7, UGF and Y1103
2
Chalcone synthase
9
6DCS, CHS1, CHS2, CHSA, CHSB, CHS CHSL1, CHSY, PKS5
3
Chalconeisomerase
4
CFI, CFI1, CFI2B, CFI3
 
4
Flavanone synthase
3
C93C1, FNSI, C93B1
5
Terpenoid synthase        
15
BAMS,   GBIS1,   GBIS2,   HUMS,   TPS TPS05, TPS07, TPS08, TPS09, TPS TPS18, TPS22, TPS26, TPS29, TPS30
6
Disease resistance
89
ADR2, CDR1, CHS1, CSA1, DF230, DR206, DRL12, DRL13, DRL14, DRL15, DRL16,DRL17, DRL18, DRL19, DRL2, DRL20,DRL21, DRL23, DRL24, DRL25, DRL26,DRL27, DRL28, DRL29, DRL3, DRL30,DRL31, DRL32, DRL33, DRL34, DRL36,DRL37, DRL38, DRL39, DRL4, DRL40,DRL41, DRL42, DRL43, DRL45, DRL5,DRL7, DRL8, DRL9, DSC1, DSC2, EDR1,EDR2, EDR2L, EDR4, LAZ5, LOV1A,NDR1, R13L1, R13L2, R13L3, R13L4,RFL1, RGA1, RGA2, RGA3, RGA4,RLM1B, RLM3, RP8HA, RP8L2, RP8L3,RP8L4, RPM1, RPP1, RPP13, RPP4, RPP5,RPP8, RPS2, RPS4C, RPS4L, RPS4W,RPS5, RPS6C, RPS6R, RPS6R, SUMM2,TAO1, WR52C, WR52N, WR52R, WR52W,Y4117
7
Antifungal
4
DEF1, DEF15, DEF2, DEF4
8
Early flowering
13
ASHH2, EFM, ELF3, ELF6, HD16N, PA
PIE1,  REF6,  RUP1,  RUP2,  SKIP,  SWC VIP6
9
Aromatic
11
5MAT,  ANTA,  AVT3A,  AVT3B,  AVT3
DDC, ISS1, PGL1, PGL2, PGL3, SOT16
10
Drought
8
AL7A1, DIS1, ERG14, HDG11, LSM5,
SAD2, SDIR1, SSP1A
11
Nematodes
2
ELF3, HSPR2
4.     Transcriptome  Analysis  in  Coriander  for  Identification  of  Candidate  Genes Against Stem Gall Disease
        The scientific community involved in Coriander improvement is recommended to use the following set of 7 primers in the process of marker assisted selection for the identification of disease defence genes in coriander genotypes
Sr.
No
GeneName
ForwardPrimer
ReversePrimer
Function
1.
RL31
GCCAAACCAAAAG
GTGAGAA
CGGATACCCTTA
GCCCAGAT
Jasmonic acid
Mediated signalingpathway
2.
A0A2Z5D8
54
CCACCGTTTCCAAT
GCTAGT
GGAATCTCTCGG
GCCTAAAC
Metal ion binding
3.
A0A166CJ74
ATTGGCTGAGCTTT
GGATTG
GGCTTGATGCTC
CATTGTTT
Regulation of
Transcription DNA-template
4.
A0A166CJ74
CACGCATTTCTCCT
CCTGAT
TCAGAGGGGGT
TTTCTGATG
DNA-template
5.
Y1934
ACTCGGTGTCACGG
TTTTTC
CAAAAGCCGAG
ATTGTGGAT
Molecular
function DNA- binding
6.
TGA10
CCCTGTTGGGAAAC
TTCGTA
GCTGCAAAGGT
CCAGCTATC
Nitrogen-
activated protein kinasebinding
7.
A0A164XUZ0
GAGTTGGAGTTCAG
GGAGGA
GATGAGCGGGA
TATCTGGAA
Affects Fungal
Development and Pathogenicityof Fusarium graminearum
5.     Elemental, Nutritional and Microbiological Analysis of Panchagavya (Ancient Liquid Organic)
       The Scientific community involved in Panchagavya research or microbial research are recommended to use 19th day old Panchagavya to study maximum microbial diversity.The higher proportion of α-proteo bacteria was observed in 19th day of Panchagavya preparation while 21st Day Panchagavya formulation was found to be dominated by Firmibacteria, β-proteobacteriaor Actinobacteria. The presence of unknown/novel microbeswere higher in 21st day old Panchagavya on the basis of results of Metagenomic analysis.
a)Panchagavya contained dominant bacteria of nitrogenfixing, phosphate solubilizers and potashmobilizers. Moreover, its how edantagonism towards plant pathogenic fungi like Helminthosporium(47%), A.flavus(45%), A.niger(35%) and Sclerotiumrolfsii(40%) invitro. Elemental composition of Panchagavya showed higher concentration of Fe(158.94ppm), Ca (2789.99ppm), Mg(1553.76 ppm) and Mo(25.50ppm). It also contained N-Methyl-2-pyrrolidinone used as in secticide, herbicideandfungicide. Phenylacetaldehyde is a second major compound found which has very important antibiotic compound.
b)  Bijamrut  elemental  analysis  revealed  that  it  contains  Cu  (4.19  ppm),  Fe (111.16ppm), Mn(1.56ppm), Zn(2.40), Ca(1211.63ppm) and Mg(1084.65 ppm) which can provide immunity against various diseases and improve seed germination. It also contained important compound5(6)-EpETrE-EA which has antagonistactivity against pathogenicmicrobes. 17beta-Nitro-5alpha-androstane is theaza-steroid which enhances the germination of plant seed.
c) Liquid organic preparation of Jivamrut has bacteria, fungi, actinomycetes, N- fixers and P-solubilizers and K-mobilizers. Jivamrut in hibited Helminthosporium (40%), A.flavus(30%), A.niger(25%) and Sclerotiumrolfsii(35%),Fusarium oxysporum(35%). Jivamrut contains high concentration of Fe (115.09ppm), Ca (1575.78 ppm), Mg (621.57ppm) and Co (88.90ppm).  LC-QToF analysis showed Pyropheophorbide  is anantioxidant  found in Jivamrut.
d)   Amrutpani   is   a   good   source   of   micronutrient   which   includes   high concentration of Fe(208.44ppm), Ca(2276.73ppm), Mg (1119.15ppm) and Ti (73.05ppm). LC-QT oF analysis revealed that AdouetineZ isaninsecticidalcyclic peptide and (5alpha,8beta,9beta)-5,9-Epoxy-3,6-megastigmadien-8-olisan antioxidant compound  found  in Amrutpani.
e)  Sanjivak has antagonist activity and micro nutrient content with important compound like Methyl jasmonate.
6.       Biochemical and Molecular Evaluation  of A1 and A2 Casein Protein of Milk in Holstein Friesian Cow and Indigenous Gir Cow
The scientific community involved in cow improvement is recommended to use DNA markers to detect or distinguish A1A2 and A2A2 genotypic frequency among the Gir Bulls and Cows using below mentioned marker.
1
A1 Forward
5’ CTTCCCTGGGCCCATCCA 3’
A1 Reverse
5’ AGACTGGAGCAGAGGCAGAG 3’
2
A2 Forward
5’ CTTCCCTGGGCCCATCCC 3’
A2 Reverse
5’ AGACTGGAGCAGAGGCAGAG 3’
7.   Studies on Phytochemicals And Metabolomics Profiling of Seaweeds
      The seaweed resources viz., Green, Red and Brown seaweeds analyzed through Ms/Ms based platform showed presence of 375 unique compounds. These seaweeds were found to contain important oil content, vitamin D3 and many bioactive compounds that can be used as nutraceutical products . In case of ω-3 polyunsaturated fatty acids, eicosapentaenoic acid (EPA) was found in seaweed species, viz., Sarconema filiforme (5.02%) and Spatoglossum asperum(4.04%). Vitamin D-3 was found in Caulerpa Lenthilifolia (16.7%), Caulerpa sertulorioides (8.5%), Ulva fasciata (10.7%) , Halimeda tuna (12.7%) , Hydroclatharus clathratus (18.9%), Halymenia venusata (6.5%), H. porphyraeformis (20.6%), Dictyopteris marginatum, Gelidiopsisrepens (18.2%) and Heterosiphonia muelleri (26.1%). Some species of seaweeds viz, Dictyopterisdelicatula (2.68%), Heterosiphonia muelleri (0.24%), Dictyopterismarginatum (stoecospermum) (4.07%), Spatoglossum asperum (8.1%), Padina gymnospora(4.86%), Caulerpa lenthilifolia (0.96%)contained docosahexaenoic acid (DHA). These compounds are not found in plants.
Year 2021-22
1.     BCJ-62: Development and characterization of polymer based nanofertilizers and their response to wheat
       Chitosan nanoparticles (CS-NPs) were synthesized and examined greater than 40 mV zeta potential indicating good stability. The urea, tricalcium phosphate and muriate of potash were used as sources for incorporation of N, P and K elements individually onto the CS-NPs and the elevation of size of the nanofertilizers, without aggregation of nanoparticles, were observed. Scanning electron micrograph illustrated spherical shape of the CS-NPs and gave the idea about the morphology of incorporated NPK nanofertilizers. The FTIR study indicated that there is a electrostatic interaction occurs between the charges of CS-NPs and the N P K elements, resulted to stretching of spectra (peak) at specific wavelength confirming the incorporation of N P and K elements on to the CS-NPs. The application of 5% NPK nanofertilizers (10 time less) on wheat suggested higher nutritional seed quality and maintained yield equivalent to chemical fertilizers. The cost-effective NPK-nanofertilizers thus developed may save the forex (subsidy) about 38.22%. It has better controlled-release system in a liquid formulation to enhance nutrient use efficiency and sustained crop growth.
2.    Isolation and identification of entomopathogenic microorganisms from the soils of Junagadh district.
      The Scientific communities involved in microbial and entomological research are recommended to use native identified entomopathogenic microbes including 213 Pseudomonas putida (MK415028.1), P. monteilii (KT881478.1), P. knackmussii (KY324901.1), P. fulva (KC293832.1), Bacillus subtilis (MH141058.1), B. thuringiensis (KY003094.1), B. clausii (AB251924.1), Enterobacter asburiae (MK 467572.1), E. cloacae (JX514409.1), Beauveria bassiana (KC753382.1), Metarhizium anisopliae (KJ573520.1) and Verticillium lecanii (AJ292383.1) for the production of biofertilizer and biocontrol agent as they suppressed Helicoverpa armigera, and have PGPR activity
3.    Isolation and identification salt tolerant strains of beneficial microorganisms from the coastal soils of Saurashtra region.
       Native halophilic bacterial strains isolated from agricultural soils of coastal regions of Saurashtra have potential for application in both industries and agriculture. The promising performance of these isolates in terms of plant growth promoting characteristics such as nitrogen fixing capacity, solubilization of phosphate and potash, production of IAA, siderophore along with production of biochemically important enzymes and bioactive compounds such as chitinase, cellulase, protease, carotene, ectoine, glycine betaine was observed. Halophilic bacterial isolates were Halomonas pacifica strain_JAU_7B (MK955347), H. pacifica strain_JAU_20A (MK575078), H. pacifica strain_JAU_22A (MK042491), H. pacifica strain_JAU_22C (MK043087), H. pacifica strain_JAU_25A (MK116946), H. pacifica strain_JAU_29A (MK114047), H. pacifica strain_JAU_36A(MK114047), H. pacifica strain_JAU_36B (MK114047), H. stenophila strain_JAU_37A (MK961217), Oceanobacillus aidingensis strain_JAU_39B (MK148253), H. pacifica strain_JAU_40B (MK114047), Bacillus haynesii strain_JAU_41A (MK157609), B. licheniformis strain_JAU_43A (MK118996), B. haynesii strain_JAU_43B (MK157608) and B. haynesii strain_JAU_45A (MK157609) which confirmed through molecular characterization by 16srRNA
4.     Biochemical appraisal of enzymatic activities from soils of permanent plot experiment at JAU, Junagadh
       The soil enzyme activity studied viz., urease, acid phosphatase, alkaline phosphatase, −Galactosidase and nitrate reductase, from the plot having different fertilizer applications, remains higher during the mid-season and found to be lower before sowing and after harvest of the crop. Minimum variation of enzyme activity was observed in a plot of only FYM treatment (25 tons/ha). The activity of urease, B−Galactosidase and B−gluosidase as well as acid phosphatase and alkaline phosphatase was enhanced by balance fertilizer application (100 % NPK (25:50:50) as per soil test as well as 25 tons/ha FYM application. The pod yield of groundnut was remained highly positively correlated with urease, acid phosphatase and alkaline phosphatase enzyme activity.
5.       Diversity analysis of fresh water diatoms through SEM-EDX from surface microalgae of water bodies of Junagadh region
       The scientific community involved in diatom study of fresh water in context to climate change and environment are recommended to use cataloguing of fresh water diatoms collection images from water bodies in and around JAU, Junagadh. Total 46 species of diatoms were identified from water bodies of Junagadh, out of which eleven genera viz., Cyclotella, Melosira, Navicula, Achnanthes, Amphora, Synedra, Nitzschia, Gomphonema, Hantzschia, Pinnularia and Fragillaria were predominant.The sizeable variation among the elements presents on freshwater algae through SEM EDAX showed the presence of all macro elements except phosphorus and nitrogen. All species of diatoms had higher amount of diversity indices including Shannon-Wiener diversity index (3.57) and Berger Parker Dominance (30.57). Morphometric analysis showed wider variability in location and species wise according to length (7.049 μm to 43.08 μm) and width (2.53 μm to 23.44 μm) as well
as diversity indices too. Willington dam site showed maximum spp. variation of diatoms than the other location.
Year 2022-23
1.         Development of biochemical and molecular markers for heat tolerance in chickpea
The chickpea genotype namely ICC-4958 was identified highly tolerant when exposed to 42/37 oC temperature at germination stage. This genotype had high antioxidant activity, ascorbic acid, glutathione, super oxide dismutase, ascorbate peroxidase, glutathione reductase along with Quinone oxidoreductase, glutaredoxine and heat shock protein 70. SSR markers namely Cam1536, TA27, TR 58 could also reveal this genotype different at DNA level. Hence, this genotype can be exploited in breeding to develop heat tolerant lines/varieties of chickpea.
2.         Diversity analysis of marine diatoms through SEM-EDX from surface microalgae of saurashtra coastal belt
The scientific community working on diatoms of coastal belt of Saurashtra are recommended to use diatoms diversity analysis done through Scanning electron microscopy as ready references. The diatom analysis of marine samples from three locations (Okha,Veraval and Aadri) identified fifty diatom species and most of them are pennate types. The Cocconeis spp, Grammatophora spp, Fragilaria sp, Nitzschia sp, Navicula sp., Achnanthes spp and Licmophora were found dominant diatoms on the surface of microalgae. Again, diatom abundance of Cocconeis scutellum was reported higher than 52% of total diatom considering three locations. The energy dispersive X-ray spectroscopy (EDS) graph prepared for individual species of diatoms from SEM images observed that the frustules of the diatoms wereother than Si. It has many elements at various sites attached to them. The catalogue of diatoms and alfa-diversity index revealed many diverse rich populations in coastal belt of Saurashtra
3.         Biochemical analysis based lipid indices of edible, non edible and medicinal herbs oils
Scientific community involved in lipid indices of edible oil research is recommended to use the sets of following biochemical based fatty acids calculation for the quality of oils and their lipid indices.
Edible oils
DR
ODR
LDR
MUFA
PUFA
SFA
DU
UI
AI
TI
GG-20
0.009
0.247
0.001
63.72
20.64
15.64
105.0
590.5
0.14
10.32
GG-21
0.008
0.185
0.003
69.62
15.67
14.71
101.0
597.0
0.13
9.18
GG-3
0.009
0.451
0.001
44.47
35.93
19.6
116.3
562.8
0.19
13.30
Coconutseedoil
0.007
0.396
0.011
11.43
7.05
81.52
25.5
129.4
20.73
34.60
Cornoil
0.012
0.563
0.005
33.24
41.43
25.33
116.1
522.7
0.67
23.17
Cottonseedoil
0.003
0.645
0.035
26.01
40.88
33.11
107.8
468.2
2.19
28.78
Soybean
0.022
0.612
0.025
23.5
53.88
22.62
131.3
541.7
0.36
14.30
Sunflower
0.007
0.630
0.019
30.71
47.09
22.2
124.9
544.6
4.32
17.60
Brownmustardseed
0.181
0.647
0.439
57.51
30.26
12.23
118.0
614.4
0.06
40.74
Whitesesame
0.001
0.558
0.011
39.17
48.19
12.64
135.6
611.5
0.09
10.00
Blacksesame
0.001
0.574
0.007
38.07
50.47
11.46
139.0
619.8
0.08
8.34
DR= Desaturation ratio; ODR= Oleic desaturation ratio; LDR= Linoleic desaturation ratio; MUFA= Monounsaturated fatty acid; PUFA= Polyunsaturated fatty acid; SFA = Saturated fatty acid; DU= Degree of unsaturation; UI= Index of unsaturation; AI= Atherogenic index; TI= Thrombogenic index
4.         Biochemical  analysis  based  lipid  indices  of  edible,  non  edible  and medicinal herbs oils
Scientific community involved in the essential oil research of the following crops are recommended to use marker bioactive compounds detected through GC MS platform
Name of crops
Important Marker Bioactive compounds
Blackpepper
(PipernigrumL.)
Piperine(α.-Phellandrene,4.64%) cis-sabinene(23.21%) Caryophyllene(13.58%) Caryophylleneoxide(0.33%)
1,4-Cyclohexadiene, 1-methyl-4-(1-methylethyl) (20.84%)
Volatileoil of
Cardamom
α-Terpinyl acetate(37.05%) Eucalyptol (25.79%) Sabinen (3.41%)
Volatileoil of
Cinnamom
Cinnamaldehyde, (E) (77.55%) Copaene(2.98%)
Volatileoil from
leavesof cinnamom
Phenol,2-methoxy-3-(2-propenyl)(79.17%)., Spathulenol(3.26%) gamma.-Elemene(3.66%)., Caryophyllene(1.24%)
Volatileoil of
cloves
Caryophyllene(37.5%)and Phenol,2-methoxy-3-(2-propenyl)-(44.04%)
Volatileoil of
corianderleaves
LINALOOL  (63.23%),2,6-Octadien-1-ol, 3,7- dimethyl-, acetate(7.78%).,1,6-Octadien-3-ol, 3,7- dimethyl(2.64%).,(1R)-2,6,6- Trimethylbicyclo[3.1.1]hept-2-ene(2.59%)
Volatileoilof
cumin seeds
Beta.-Pinene(19.09%) Benzene, 1-methyl-4-(1-methylethyl)(12.4%)
1,4-Cyclohexadiene,1-methyl-4-(1-methylethyl)  (10.69%) Benzaldehyde, 4-(1-methylethyl)(26.8%) TERPIN-7-AL <GAMMA-> DB5-1106 (12.36%)
Volatileoil of
curryleaves
Bicyclo[7.2.0]undec-4-ene, 4,11,11-trimethyl-8-
methylene-, [1R-(1R@,4Z,9S@)](29.28%) Caryophyllene(4.44%),.alpha.-Caryophyllene(4.88%) Azulene, 1,2,3,3a,4,5,6,7-octahydro-1,4-dimethyl-7-(1- methylethenyl)-(21.24%) [1R-.alpha.,3a.beta.,4.alpha.,7.beta.)]-Caryophyllene oxide (4.05%).
Volatileoil ofDill
seed
Tetrahydro carvone (19.82%) trans-dihydrocarvone(14.53%) cis-Carvylacetate (25.7%) Eugenol(0.01%) And Apiol(Abotiondrug)(17.59%)
Volatile  oil ofDry
ginger
CURCUMENE (16.56%) Zingiberene(21.03%); FARNESENE <(E,E)-ALPHA(15.26%) beta-Sesquiphellandrene (7.61%) VALERIANOL (5.91%)
Volatileoil of
fennel seed
Fenchone(8.93%)  Anisole, p-allyl(5.29%) (Estragole) cis-Anethol (68.56%)
VolatileofGarlic
oil
1,3-Dithiane(6.7%) Dimethyltrisulfide(7.43%) Diallyl disulphide(17.72%) Hydroperoxide, 1,4-dioxan-2-yl (26.34%) Trisulfide, di-2-propenyl (31.49%)
Volatileoil ofholy
basil
1,6-Octadien-3-ol, 3,7-dimethyl (18.47%)/(Linalool)
METHYLCINNIMATE(8.48%) and METHYL CINNIMATE<(E)-(45.94%)
Volatileoil ofmint
leaves
Limonene(5%) 2-Cyclohexen-1-ol, 2-methyl-5-(1-methylethenyl)-, trans-(35.63%) 2-Cyclohexen-1-one, 2-methyl-5-(1-methylethenyl)
(31.59%) trans-Carveyl acetate(5.19%)
Volatileoil of
nutmeg
1R)-2,6,6-Trimethylbicyclo[3.1.1]hept-2-ene/ (α-Pinene-14.64%)
Bicyclo[3.1.0]hexane, 4-methylene-1-(1-methylethyl)- ( cis-sabinene-18.5%) Cyclohexene, 1-methyl-4-(1-methylethenyl)-, (S)-( Limonene-5.84%) 1,4-Cyclohexadiene, 1-methyl-4-(1-methylethyl)-( α- Terpinene-5.13%) 3-Cyclohexen-1-ol, 4-methyl-1-(1- methylethyl)-( (R)-(-)-; (-)-Terpinen-4-ol-8.05%) Benzene, 1,2-(methylenedioxy)-4-propenyl-, (E)-( (β- Isosafrole-5.4%)
Volatileoil of
nutmegmace
α-Pinene-(15.97%);. cis-sabinene-(17.66%);α- Terpinene-(6.23%), L-4-terpineol-(9.11%)
Turmericoil
&Oleoresin
Caryophyllene(6.74 %and 0.29,% ) ZINGIBERENE(18.86%and 4.59%) Benzene,1-(1,5-dimethyl-4-hexenyl)-4-methyl(9.49%
and 0.45%) SESQUIPHELLANDRENE     <BETA(14.25%     and
1.17% ) Tumerone(23.26% and17.39%) Ar-tumerone(25.15% and8.93%)
5. Dr PJ.Rathod is the one of the inventor in Patent Granted on A PROCESS OF ENZYMATIC PRE-TREATMENT ON VARIETIES OF PIGEON PEA which was filled in 29/01/2020 and Granted on 21/12/2023. Application number: 202021004030
Year 2023-24
1. BCJ - 64: Development of biochemical and molecular markers for heat tolerance in chickpea
The chickpea genotype namely ICC-4958 was identified highly tolerant when exposed to 42/37 oC temperature at germination stage. This genotype had high antioxidant activity, ascorbic acid, glutathione, super oxide dismutase, ascorbate peroxidase, glutathione reductase along with Quinone oxidoreductase, glutaredoxine and heat shock protein 70. SSR markers namely Cam1536, TA27, TR 58 could also reveal this genotype different at DNA level. Hence, this genotype can be exploited in breeding to develop heat tolerant lines/varieties of chickpea.
2. BCJ-65: Biochemical analysis based lipid indices of edible, non edible and medicinal herbs oils
Recommendation- I
Scientific community involved in lipid indices of edible oils research is recommended to use the sets of following biochemical based fatty acids calculation for the quality of oils and their lipid indices.
Edible oils
DR
ODR
LDR
MUFA
PUFA
SFA
DU
UI
AI
TI
GG -20
0.009
0.247
0.001
63.72
20.64
15.64
105.0
590.5
0.14
10.32
GG-21
0.008
0.185
0.003
69.62
15.67
14.71
101.0
597.0
0.13
9.18
GG-3
0.009
0.451
0.001
44.47
35.93
19.6
116.3
562.8
0.19
13.30
Coconut seed oil
0.007
0.396
0.011
11.43
7.05
81.52
25.5
129.4
20.73
34.60
Corn oil
0.012
0.563
0.005
33.24
41.43
25.33
116.1
522.7
0.67
23.17
Cotton seed oil
0.003
0.645
0.035
26.01
40.88
33.11
107.8
468.2
2.19
28.78
Soybean
0.022
0.612
0.025
23.5
53.88
22.62
131.3
541.7
0.36
14.30
Sunflower
0.007
0.630
0.019
30.71
47.09
22.2
124.9
544.6
4.32
17.60
Brown mustard seed
0.181
0.647
0.439
57.51
30.26
12.23
118.0
614.4
0.06
40.74
White sesame
0.001
0.558
0.011
39.17
48.19
12.64
135.6
611.5
0.09
10.00
Black sesame
0.001
0.574
0.007
38.07
50.47
11.46
139.0
619.8
0.08
8.34
DR=Desaturation ratio; ODR= Oleic desaturation ratio; LDR= Linoleic desaturation ratio; MUFA =  Monounsaturated fatty acid; PUFA = Polyunsaturated fatty acid; SFA = Saturated fatty acid; DU= Degree of unsaturation; UI= Index of unsaturation; AI= Atherogenic index; TI= Thrombogenic index
Recommendation- II
Scientific community involved in the essential oil research of the following crops are recommended to use bioactive compounds detected through GC MS platform as a markers
Name of crops
Important Marker Bioactive compounds
Black pepper (Piper nigrum L.)
Piperine (α.-Phellandrene, 4.64%)
cis-sabinene (23.21%)
Caryophyllene (13.58%)
Caryophyllene oxide (0.33%)
1,4-Cyclohexadiene, 1-methyl-4-(1-methylethyl) (20.84%)
 Volatile oil of Cardamom
α-Terpinyl acetate (37.05%)
Eucalyptol (25.79%)
Sabinen (3.41%)
Volatile oil of Cinnamom
Cinnamaldehyde, (E) (77.55%)
Copaene (2.98%)
Volatile oil from leaves of cinnamom
Phenol, 2-methoxy-3-(2-propenyl) (79.17%).,
Spathulenol (3.26%)
gamma.-Elemene (3.66%).,
Caryophyllene (1.24 %)
Volatile oil of cloves
Caryophyllene (37.5%) and
Phenol, 2-methoxy-3-(2-propenyl)-(44.04%)
Volatile oil of coriander leaves
LINALOOL  (63.23%),  2,6-Octadien-1-ol, 3,7-dimethyl-, acetate(7.78%).,1,6-Octadien-3-ol, 3,7-dimethyl(2.64%).,(1R)-2,6,6-Trimethylbicyclo[3.1.1]hept-2-ene (2.59%)
Volatile oil of cumin seeds
Beta.-Pinene (19.09%)
Benzene, 1-methyl-4-(1-methylethyl) (12.4%)
1,4-Cyclohexadiene, 1-methyl-4-(1-methylethyl) (10.69%)   
Benzaldehyde, 4-(1-methylethyl) (26.8%)
TERPIN-7-AL <GAMMA-> DB5-1106 (12.36%)
Volatile oil of curry leaves
Bicyclo[7.2.0]undec-4-ene, 4,11,11-trimethyl-8-methylene-,[1R-(1R@,4Z,9S@)] (29.28%)
Caryophyllene (4.44%),.alpha.-Caryophyllene(4.88%)
Azulene, 1,2,3,3a,4,5,6,7-octahydro-1,4-dimethyl-7-(1-methylethenyl)-(21.24%)
[1R-.alpha.,3a.beta.,4.alpha.,7.beta.)]-Caryophyllene oxide (4.05%).
Volatile oil of Dill seed
Tetrahydro carvone (19.82%)
trans-dihydrocarvone (14.53%)
cis-Carvyl acetate (25.7%)
Eugenol (0.01%)
And Apiol (Abotion drug) (17.59%)
Volatile  oil of Dry ginger
CURCUMENE (16.56%)
Zingiberene (21.03%);
FARNESENE <(E,E)-ALPHA (15.26%)
beta-Sesquiphellandrene (7.61%)
VALERIANOL (5.91%)
Volatile oil of fennel seed
Fenchone (8.93%)
Anisole, p-allyl(5.29%) (Estragole)
cis-Anethol (68.56%)
Volatile of Garlic oil
1,3-Dithiane (6.7%)
Dimethyl trisulfide (7.43%)
Diallyl disulphide (17.72%)
Hydroperoxide, 1,4-dioxan-2-yl (26.34%)
Trisulfide, di-2-propenyl (31.49%)
Volatile oil of holy basil
1,6-Octadien-3-ol, 3,7-dimethyl (18.47%)/(Linalool)
METHYL CINNIMATE (8.48%) and METHYL CINNIMATE <(E)-(45.94%)
Volatile oil of mint leaves
Limonene (5%)
2-Cyclohexen-1-ol, 2-methyl-5-(1-methylethenyl)-, trans-(35.63%)
2-Cyclohexen-1-one, 2-methyl-5-(1-methylethenyl) (31.59%)
trans-Carveyl acetate (5.19%)
Volatile oil of nutmeg
1R)-2,6,6-Trimethylbicyclo[3.1.1]hept-2-ene/ (α-Pinene-14.64%)
Bicyclo[3.1.0]hexane, 4-methylene-1-(1-methylethyl)-( cis-sabinene-18.5%)
Cyclohexene, 1-methyl-4-(1-methylethenyl)-, (S)-( Limonene-5.84%)
1,4-Cyclohexadiene, 1-methyl-4-(1-methylethyl)-( α-Terpinene-5.13%) 3-Cyclohexen-1-ol, 4-methyl-1-(1-methylethyl)-( (R)-(-)-; (-)-Terpinen-4-ol-8.05%)
Benzene, 1,2-(methylenedioxy)-4-propenyl-, (E)-( (β-Isosafrole-5.4%)
Volatile oil of nutmeg mace
α-Pinene-(15.97%);. cis-sabinene-(17.66%);α-Terpinene-(6.23%), L-4-terpineol-(9.11%)
Turmeric oil
& Oleoresin
Caryophyllene (6.74 %and 0.29,% )
ZINGIBERENE (18.86% and 4.59%)
Benzene, 1-(1,5-dimethyl-4-hexenyl)-4-methyl (9.49% and 0.45%)
SESQUIPHELLANDRENE <BETA(14.25% and 1.17% )
Tumerone (23.26% and 17.39%)
Ar-tumerone (25.15% and 8.93%)
3. BCJ-66: Diversity analysis of marine diatoms through SEM-EDX from surface microalgae of saurashtra coastal belt
The scientific community working on diatoms of coastal belt of Saurashtra are recommended to use diatoms diversity analysis done through Scanning electron microscopy as ready references. The diatom analysis of marine samples from three locations (Okha,Veraval and Aadri) identified fifty diatom species and most of them are pennate types. The Cocconeis spp,Grammatophora spp, Fragilaria sp, Nitzschia sp, Navicula sp., Achnanthes spp and Licmophora were found dominant diatoms on the surface of microalgae. Again, diatom abundance of Cocconeis scutellum was reported higher than 52% of total diatom considering three locations. The energy dispersive X-ray spectroscopy (EDS) graph prepared for individual species of diatoms from SEM images observed that the frustules of the diatoms were other than Si. It has many elements at various sites attached to them. The catalogue of diatoms and alfa-diversity index revealed many diverse rich populations in coastal belt of Saurashtra.
Year 2024-25
1. Biotech 08: Improvement of Groundnut oil quality for high oleic acid through CRISPR/Cas gene editing technology
The scientific community involved in groundnut improvement through genome editing technology is recommended to use the optimized tissue culture protocol using de-embryonated cotyledone as explants (multiple shoot formation: MS + 25.0 mg/l 6-benzylaminopurine, shoot elongation: MS + 3.0 mg/l 6-benzylaminopurine, + 1.0 mg/l gibberellic acid, root induction: MS + 1.0 mg/l naphthalene acetic acid), CRISPR/Cas9 technology and binary vector for successfully editing the gene of interest (AhFAD2B) in groundnut for achieving high O/L ratio (8.52). A single guide RNA sequence (5'TGTGGTCTATGATCTGTTAATGG3'), designed by using CHOPCHOP, was utilized to guide the Cas nuclease for precise editing.
On-Going Research Schemes/Projects
Sr. No.
Title and BH
Funding agency
Principal Investigator
Period
Sanctioned Amount
(Rs. In lakh)
From
To
1.
Establishment of Department of Biotechnology at College of Agriculture, Junagadh. (12401)
Gov. of Gujarat
Professor & Head
2008-09
Conti..
248.95
2.
Improvement of Agriculture production through Nanotechnology Inventions (12402)
Gov. of Gujarat
Professor & Head
2008-09
Conti..
73.65
3.
Research in Bio-Technology at Junagadh (12044-1)
Gov. of Gujarat
Professor & Head
1994-95
Conti..
13.45
4.
Molecular mapping of important traits and their transfer through marker assisted selection (MAS) in groundnut and cotton
(12029)
Gov. of Gujarat
Professor & Head
2014-15
Conti..
56.30
5.
Microbial, Meta-omics and On-farm Evaluation study on Biostimulants (Beejamrit and Dravajivamrit) and  Biorationals (Neemastra and Dashaparni Ark) (18024-17)
Gujarat State Biotechnology Mission, Gandhinagar
(GSBTM- DST)
M. V. Parakhiya
2022-23 to 2024-25
(Three year)
Conti..
74.47
Research experiments conducted (2019-20)
Sr. No.
Title
1.
Studies on phytochemicals and metabolomics profiling of seaweeds
2.
Elemental, nutritional and microbiological analysis of panchagavya  (ancient liquid organic)
3.
Biochemical appraisal of enzymatic activities from soils of  LTFE at JAU, Junagadh.  
4.
Biochemical and molecular evaluation  of A1 and A2 casein protein of milk in holstein friesian cow and indigenous Gir cow
5.
Comparative appraisal of cow (Gir) and buffalo (Jaffarabadi) urine for anticancerous properties through biochemical and cytotoxic characterization
6.
Isolation and identification of entomopathogenic microorganisms from the soils of Saurashtra region
7.
Isolation and identification salt tolerant strains of beneficial microorganisms from the coastal soils of Saurashtra region.
8.
Development and characterization of polymer based nanofertilizers and their response to wheat
9.
Soil and water appraisal of organic farms in Saurashtra region
10.
Development of biochemical and molecular markers for heat tolerance in chickpea
11.
Biochemical analysis based lipid indices of edible, non edible and medicinal herbs oils.
12.
Diversity analysis of marine diatoms through sem-edx from surface microalgae of saurashtra coastle belt.
13.
Diversity analysis of fresh water diatoms through sem-edx from surface microalgae of water bodies of Junagadh region.
14.
Genome sequencing of cumin (Cuminum cyminum) to reveal insight of its genomic architecture
15.
Transcriptome analysis in coriander for identification of candidate genes against stem gall disease
16.
Transcriptome and Proteomic characterization for identification of candidate genes responsible for pistillate inflorescence and its reversion in castor
17.
Construction of genetic linkage map and identification of QTL's linked to stem rot resistance in groundnut.
18.
Genome and transcriptome sequencing of coriander (Coriandrum sativum) to reveal insight of its genomic architecture and breeding targets
19. Characterization of Transcription Factors (Tfs) Involved in ABA -Dependent Signal Transduction in Peanut
Research experiments conducted (2024-25)
Sr. No.
Title
1.     
Characterization of transcription factors (TFs) involved in ABA dependent signal transduction in Peanut
2.     
Improvement of antioxidant and defense properties of Tomato using Bacillusspp.
3.     
Marker-assisted backcrossing to develop foliar disease-resistant genotypes in GJG-22 variety of peanut (Arachis hypogaea L.)
4.     
Molecular characterization of sesame genotypes using SRAP markers
5.     
Microbial and Meta-omics study on Biostimulants (Beejamrit and Dravajivamrit) and Biorationals (Neemastra and Dashaparni Ark).
6.     
Genome-wide transcriptome analysis of soybean under varying water-deficit conditions
7.     
Genome-wide transcriptome analyses for identification of candidate gene(s) under climate resilience in pearl millet
8.     
Study of flowering gene dynamics in Kesar Mango
9.     
Functional validation of genes controlling flowering time in groundnut (Arachis hypogaea L.) through CRISPR/Cas9
10. 
Comparative study of nutritional composition and non targeted etabolites (volatile compounds) among different cultivars and indigenous genotypes of Mango  (Mangifera indica)
New technical programmes proposed (2020-21)
Sr. No.
Title
1.
Development of nanoparticles labelled immuno-strip for rapid detection of aflatoxin in groundnut.
2.
QTL mapping and identification of markers linked to salinity tolerance in chickpea (Cicer arietinum L.).
3.
Improvement of Groundnut oil quality for high oleic acid through CRISPR/Cas gene editing technology
4.
Improvement of tomato genotype for high lycopene content and delayed fruit ripening using CRISPR-Cas genome editing technology
5.
Characterization of transcription factors (TFs) involved in ABA dependent signal transduction in Peanut
New technical programmes proposed (2021-22)
Sr. No.
Title
1.
Nutritional, antinutritional and molecular characterization of selected genotypes of chickpea.
2.
Improvement of antioxidant and defense properties of Tomato using Bacillus spp.
3.
Optimization of regeneration protocol using different plant growth regulator in Pomegranate (Punica granatum L.) cv. 'Bhagwa' cultivar
New technical programmes proposed (2022-23)
1.
Marker-assisted backcrossing to develop foliar disease-resistant genotypes in GJG-22 variety of peanut ( Arachis hypogaea L.)
2.
Molecular characterization of sesame genotypes using SRAP markers
3.
Genome-wide transcriptome analysis of soybean under varying water-deficit conditions
4.
Genome-Wide Transcriptome Analyses for Identification of Candidate Gene(S) Under Climate Resilience in Pearl Millet
5.
Study of flowering gene dynamics in Kesar Mango
6.
Microbial and Meta-omics studyon Biostimulants (Beejamrit and Jivamrit) and Biorationals (Neemastra and Dashaparni Ark)
New technical programmes proposed (2024-25)
Sr. No.
Title
1.     
Elixir Potential of Bitter gourd through metabolic and minerals profiling
2.     
Metabolic and mineral profiling of edible wild Reishi mushroom
3.     
Phytochemicals and minerals decoding in different species of leaf used as botanical pesticides in natural farming
4.     
Cataloguing of Pollen morphology of Agriculturally important crops through Scanning Electron Microscopy
5.     
Phytochemicals and minerals compounds detection in Individual powder used as botanical pesticides in natural farming
6.     
Molecular identification, antimicrobial properties and phytochemical profiling of endophytes isolated from Moringa (Moringa oleifera) and Betel (Piper betel) leaves
7.     
Comparative study of nutritional composition and non targeted metabolites (volatile compounds) among different cultivars and indigenous genotypes of Mango  (Mangifera indica)
Projects Completed
Sr. No.
Title
PI & Co-PI
Grant
(Rs. lakh)
Duration
1.
Mapping of marine fish biodiversity usingmtDNA barcoding.
Dr. M.V. Parakhia (Co-PI)
Dr. Rukam Singh Tomar
(Co-PI)
19.68
2013-14 to 2015-16
2.
Evaluation of fishmeal substitution  with  plant proteinsinformulated feedin rohu through nutrigenomics approach.
Dr. Rukam Singh Tomar
(Co-PI)
14.65
2013-14 to 2015-16
3.
Biochemical and molecular characterization of BasillusSpp. Isolated from Rhizosphere of plant and their biochemical potentials against Fusarium oxysporum f. Sp.Cumini. B.H. 18024-11
Dr. H. P. Gajera
Associate Professor (PI)
14.50
2014-15 to 2016-17
4.
Transcriptome and Proteomic characterization for identification of candidate gene responsible for pistillate inflorescence and its reversion in castorB/H: 2030-07
R. S. Tomar (PI)
Dr. M.V. Parakhia (Co-PI
65.00
2015-16 to 2017-18
5.
Transcriptome analysis in coriander for identification of candidate genes against stem gall disease. B/H:2030-08 
R. S. Tomar (PI)
Dr. M.V. Parakhia (Co-PI
35.20
2015-16 to 2017-18
6.
Genome andtranscriptome sequencingofcumin toreveal insight of itsgenomic architecture.
Dr. Rukam Singh Tomar (PI)
Dr. M.V. Parakhia (Co-PI
34.65
2015 to 2017
7.
Synthesis and characterization of chitosan based NPK-Nano fertilizers (18024-12)
Dr. H. P. Gajera (PI)
4.12
2017-18 to 2019-20
8.
Genome and transcriptome sequencing of coriander (Coriandrum sativum) to reveal insight its genomic architecture and breeding targets (18024-13)
Dr. R. S. Tomar (PI)
Dr. M.V. Parakhia (Co-PI
25.41
2017-18 to 2019-20
9.
To identify the Candidate biocontrol agent putatively involved in biocontrol of plant disease
(18024-14)
Dr. M. V. Parakhia (PI)
6.00
2018-19 to 2019-20
Any other relevant information related to department
Awards/Recognition Received by Faculty (During years 2015-16 to 31 Aug-2020 year-wise)
Sr. No.
Name of Faculty
Name of Award
Authority
Year
Year 2015-16
1.
Dr. H. P. Gajera
Best Teacher  Award
College of Agriculture, JAU, Junagadh
2015-16
2.
Dr. S. B. Bhatt
1000 samples of Soil analysis completed by 4h, 25min and  40sec. Nominate forLimca Book of World Record
Limca Book of World Record
2016-17
3.
V. B. Rathod
1000 samples of Soil analysis completed by 4h, 25min and  40sec. Nominate for Limca Book of World Record
Limca Book of World Record
2016-17
Year 2016-17
4.
Dr. R. S. Tomar
Best Teacher  Award
College of Agriculture, JAU, Junagadh
2016-17
5.
Dr. S. B. Bhatt
Golden Book of World Record
Golden Book of World Records authority
2017-18
Year 2017-18
6.
Dr. H. P. Gajera and
Dr. B. A. Golakiya
Krishi Shiksha Samman, National Award Winner
Mahindra Samriddhi India Agri awards-2018
(Institute Awards for the work on nanotechnology and nanofertilizers). This is in recognition to an agricultural university for their purposeful and noteworthy contribution to the field of Agriculture, having a positive impact on the farming communities, thus enabling them to RISE
Mahindra and Mahindra Ltd., Mumbai
2017-18
7.
Dr. R. S. Tomar
Dr.  V. P. Gokhale Award
Maharashtra Association for the Cultivation of Science, Pune
2017-18
8.
Dr. R. S. Tomar
Best Researcher Award
IRDP Group, 2/5, Krishna Industrial Estate, Mettukuppam, Vanagaram, Chennai- 600095, Tamil Nadu, India.
2017-18
9.
Dr. S. B. Bhatt
Best Young Faculty Award in the field of Biotechnology
Education Expo EET,CRS
2017-18
10.
Dr. S. B. Bhatt
Best Young Women Scientist Award
Samagra Vikas Welfare Society, Lucknow
2017-18
Year 2018-19
11.
Dr. H. P. Gajera
Dr. Sarvapalli Radhakrishnan life time achievement award for Teaching, Research and Publications
IRDP Group of Journals, Chennai
2018-19
12.
Dr. H. P. Gajera
Teaching and Research Excellence National Award
IRDP Group of Journals, Chennai
2018-19
13.
Dr. U. K. Kandoliya
Dr. Sarvapalli Radhakrishnan life time achievement award for Teaching, Research and Publications
IRDP Group of Journals, Chennai- 600095, Tamil Nadu, India.
2018-19
14.
Dr. Manoj V. Parakhia
Best Scientist National Award
IRDP, group of journals
2018-19
15.
Dr. Manoj V. Parakhia
Young Scientist Award
Samagra Vikas Welfare Society (SVWS)
2018-19
16.
Dr. Rukam Singh Tomar
Young Scientist Award
SamagraVikas Welfare Society
2018-19
Year 2019-20
17.
Dr. Manoj V. Parakhia
Young Achiever Award
Institute of Scholars (InSc), Bangalore
2019-20
18.
Dr. Manoj V. Parakhia
Teacher Innovation Award 
Zero-Investment Innovations for education Initiatives (ZIIEI)
2019-20
19.
Dr. Rukam Singh Tomar
Outstanding Researcher Award
Aufau Science Forum and Chemical Science Review and Letters, Salem, India.
2019-20
20.
Dr.A. G. Vala
Yound Achiever Award
Institute of Scholars 
2020
Year 2021-22
21.
Dr. Manoj V. Parakhia
Best Faculty
Education Expo EET,CRS
2021-22
22.
Dr.A. G. Vala
Young Scientist Awards
Asia-Pacific: SCIFAX
2022
Year 2022-23
23.
Dr S B Bhatt
Academic Excellence Award
Institute of Scholars
2023
24.
Dr S B Bhatt
Young Researcher Award
Institute of Scholars
2023
25.
Dr.A. G. Vala
Young Scientist Awards
ScienceFather
2023
Year 2023-24
26.
Dr S B Bhatt
Senior Scientist Award –Gujarat State
Microbiology society of India
2023
27.
Dr. S. B. Bhatt
Academic Excellence Award
InSc Pune
2023
28.
Dr. S. B. Bhatt
Young Researcher Award
InSc Pune
2023
29.
Dr. S. B. Bhatt
Distinguished Scientist award
Gujarat Natural Farming and Science University, Anand, India.
2023
30.
Dr. M.V. Parakhia
Excellence in Research award
Gujarat Natural Farming and Science University, Anand, India.
2024
31.
Dr.A.G.Vala
Young Researcher Award
Institutional Research
2024
32.
Dr. Jay. M. Khaniya
Best Article Award
Agri Articles (E-Magazine, ISSN: 2582-9882)
2024
Year 2024-25
33.
Dr. S. B. Bhatt
Best Article Award
The science World International Magazine
2024
Awards Received by PG Students (During years 2015-16 to 31 Aug-2020 year-wise)
Sr. No.
Name of Student
Name of Guide
Name of Award
Awardee
Year
Year 2016-17
1.
Bharose Achyut Ashokrao
Ph. D. Student
(Reg.No.J4-01335-2014)
Dr. H. P. Gajera
Best PG research under Agriculture category and
secured First position in west zone students research convention
 
Anveshan – 2016 Students research convention (west zone) at
Maharaja Ganga Singh University, Bikaner, Rajasthan, January 12-13, 2016
January 12-13, 2016
2.
Hirpara Darshna G.
Ph. D. Student
(Reg. No. 1010115007)
Dr. H. P. Gajera
Chancellor’s Gold Medal for the best overall performance in M.Sc. (Agri.) Degree
Twelth Convocation of Junagadh Agricultural University, Junagadh,
12th January 2017
3.
ThoppurathuFeba Jacob
(Reg. No. 2010116121)
Dr. A. G. Vala
Vice Chancellor’s Gold Medal for the best overall performance in B.Sc. (Agri. Biotech) Degree
Twelfth Convocation of Navsari Agricultural University, Navsari
28th January 2017
4.
Suhail Ahmad  A. Hakeem
Ph. D. Student
(Reg. No.J4-01418-2014)
Dr. H. P. Gajera
Poster Presentation
Department of Biochemistry, Saurashtra University, Rajkot
4th March 2017
5.
Parmar Krupalkumar A.
M.Sc. Student
(Reg. No. 2010116087)
Dr. P. J. Rathod
Poster Presentation
Christ College, Rajkot,
February 26 & 27,2017
6.
Jasminkumar V. Kheni
Ph. D. Student
(Reg. No.J4-01151-2013)
Dr. B. A. Golakiya
Young Scientist
Mehsana Urban Institute of Science, Ganpat University, Mehsana, Gujarat, India
2017
7.
Hirpara Darshna G.
Ph. D. Student
(Reg. No. 1010115007)
Dr. H. P. Gajera
Young Scientist
Samagra Vikash Welfare Society & Bharatiy Cine Karmachari Sangh, Lucknow
2017
Year 2017-18
1.
Suhail Ahmad  A Hakeem
Ph. D. Student
(Reg. No.J4-01418-2014)
Dr. H. P. Gajera
Best oral research presentation in the subject of Biotechnology
10th National Science Symposium on "Recent Trends in Science and Technology" at Christ College, Rajkot
February 10, 2018
Year 2018-19
1.
Hirpara Darshna G.
Ph. D. Student
(Reg. No. 1010115007)
Dr. H. P. Gajera
Prestigious IRDP Awards - 2018
(Sir C. V. Raman Life Time Achievement National Award)
IRDP Group of Journals,  #2/5, Krishna Industrial Estate,  Mettukuppam, Vanagaram,  Chennai-600095
2018
2.
Savaliya Disha D.
Ph. D. Student
(Reg. No. J4-00408-2008)
Dr. M. K. Mandavia
Prestigious IRDP Awards - 2018
(Best Young Researcher National Award)
 
IRDP Group of Journals,  #2/5, Krishna Industrial Estate,  Mettukuppam, Vanagaram,  Chennai-600095
2018
3.
Suhail Ahmad  A Hakeem
Ph. D. Student
(Reg. No.J4-01418-2014)
Dr. H. P. Gajera
Best oral presentation (Second prize)
National conference on "Enhancing productivity of oilseeds in changing climate scenario" at ICAR-Directorate of Groundnut Research, Junagadh
April 7-9, 2018
Year 2020-21
1.
Hirpara Darshna G.
Ph. D. Student
(Reg. No. 1010115007)
Dr. H. P. Gajera
ICAR National Award - 2019:
Jawaharlal Nehru Award for Outstanding Doctoral Thesis Research in Agricultural and Allied Sciences 2019 in the category of Biotechnology
92nd foundation day of  ICAR and award ceremony at Indian Council of Agricultural Research (ICAR), New Delhi
July 16, 2020
2.
 
Savani Khyati R.
(Reg. No. 1010115007)
Ph. D. Student
2021-2023
Dr. H. P. Gajera
Award for Prime Minister’s Fellowship for Doctoral Research 
Title of Ph. D.Thesis
Transcriptome and biochemical depictions of developing anther influenced by salicylic acid functionalized nanochitosan under heat stress in cotton (Gossypium hirsutum L.)
A PPP Initiative of Science & Engineering Research Board (SERB) Department of Science & Technology,
Government of India and Confederation of Indian Industry (CII) 
2021-2023
Year 2021-22
1.
Bhadani Rushita V.
(Reg. No. 1010117002)
Ph. D. (Agri.) PMBB
Dr. H. P. Gajera
Dr. A. V. Barad´s Late Parents Smt. Amarba & Shri Virsangbhai barad Memorial Gold Plated Silver medal for securing highest overall grade point average in faculty of Agriculture or Horticulture in Doctoral Degree
Junagadh Agriculture University, Junagadh
8th Jan, 2022
 
2.
Savani Khyati R.
(Reg. No. 1010115007)
PMBB
Dr. H. P. Gajera
2nd position for oral presentation of research paper entitled “Metabolomics of developing anthers and sepals influenced by salicylic acid functionalized nano-chitosan particles to attenuate damage
International Conference on Biotechnological Initiative for climate resilient Agriculture at RPCAU, PUSA, Bihar
Jan 7-9th, 2022
Year 2022-23
1.
Hirpara Darshna Gordhanbhai
(1010115007)
Ph. D. (PMBB)
 
Dr. H. P. Gajera
Best Ph. D. thesis award – 2018 & 2019:
 
The Gujarat Association for Agricultural Sciences (GAAS), Ahmedabad
Held at Gujarat Vidyapith, Ahmedabad
2nd February, 2023
2.
Hirpara Darshna Gordhanbhai
(1010115007)
Ph. D. (PMBB)
Dr. H. P. Gajera
Shri Chaitanya Mehta Award -2020:
For Commendable presentation of Ph. D. Thesis work sponsored by Dr. K. G. Mehta, Ahmedabad
The Gujarat Association for Agricultural Sciences (GAAS), Ahmedabad
Held at Gujarat Vidyapith, Ahmedabad
2nd February, 2023
 
3.
Hirpara Darshna Gordhanbhai
(1010115007)
Ph. D. (PMBB)
Dr. H. P. Gajera
Best oral presentation - first prize
 
National Conference on “Emerging Paradigm in Agricultural Microbiology” held on February 11th, 2023 at Atmiya University, Rajkot.
February 11th, 2023
Year 2024-25
1.
Trivedi Sandhya Kiritbhai
Dr. H. P. Gajera
For Best Ph. D. Thesis Work for the year 2020-21
from JAU, Junagadh
The Gujarat Association for Agricultural Sciences (GAAS), Ahmedabad
2024
2.
Lokesh M.
Dr. S. B. Bhatt
Poster Presentation
Department of Life Science, Faculty of Science, Sigma University, Vadodara
2025